1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nlexa [21]
3 years ago
11

Obtain a copy of the Student Guide for this lab. Your teacher may provide a copy, or you can click the link to access it. Be sur

e to read the entire Student Guide for this lab. Did you read the Student Guide carefully? yes no
Biology
2 answers:
Sindrei [870]3 years ago
6 0
Your answer is yes !!!!!!!!!!!
faust18 [17]3 years ago
4 0

Answer:

YYYYYYEEEEEEEEEEEESSSSSSSSSSSS!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Explanation:

You might be interested in
Whats your cells first source for energy and where is it stored?
alexandr402 [8]

Answer: Carbohydrates, or carbs, are sugar molecules. Along with proteins and fats, carbohydrates are one of three main nutrients found in foods and drinks. Your body breaks down carbohydrates into glucose. Glucose, or blood sugar, is the main source of energy for your body's cells, tissues, and organs.

3 0
3 years ago
Read 2 more answers
What is the worse color for photosynthesis?
marin [14]

hot pink......................................

7 0
3 years ago
Read 2 more answers
In an Ecosystem Which Would Have a Larger Population, Producers or Primary Consumers?? Explain.
Svet_ta [14]
Producers, because according to food pyramid, only 10% of energy is passed onto the next layer, where the other 90 is passed off as heat, so there must be more producer in order to sustain the ecosystem.
4 0
3 years ago
What extraembryonic membrane allows for the symmetrical development of the embryo?
tresset_1 [31]

The extraembryonic membrane allows for the symmetrical development of the embryo Reconstruction debate that had federalism debate that had been an issue since the 1790s.

Reconstruction failed by most other measures: Radical Republican legislation ultimately failed to protect former slaves from white persecution and failed to engender fundamental symmetrical to the social fabric of the South. When President Rutherford B. federalism debate that had been an issue since the 1790s almost symmetrical . Hayes removed federal troops from the South in 1877, former Confederate officials and slave returned to With the support of a conservative Supreme Court, these newly empowered white southern politicians passed black codes, voter qualifications, and other anti-progressive legislation to reverse the rights that blacks had gained during Radical Reconstruction. The U.S. Supreme Court bolstered this federalism anti-progressive movement federalism  with decisions in the Slaughterhouse Cases, the Civil Rights Cases, and United States v.

Learn more about Reconstruction on:

brainly.com/question/24761999

#SPJ4

6 0
2 years ago
If you found two fossils in two different layers of sedimentary rock stacked on each other, how would you know which is older?
stira [4]
The lower the fossil the older it is.

So, if two fossils were in different layers of sedimentary rock, the lowest fossil is older.
5 0
3 years ago
Other questions:
  • What is the difference between sporozoites and merozoites
    8·2 answers
  • Animals store most of their excess energy reserves as _______ because
    11·2 answers
  • 4. Juan’s family has a history of sickle cell disease. His father died of sickle cell disease complications when Juan was six ye
    13·1 answer
  • Taxol is an anticancer drug extracted from the pacific yew tree that binds to microtubules and prevents their depolymerization.
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Match the layer of earth with its characteristics
    5·1 answer
  • Who used a compound microscope to see chambers within cork amd named them cells
    12·2 answers
  • Does a flower have a simple or complex structure
    9·2 answers
  • Which of the following statements about an energy pyramid is NOT correct?
    11·1 answer
  • True or false During meiosis, the number of chromosomes in each cell stays the same.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!