1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
3 years ago
6

Does mollusks exhibit bilateral symmetry?

Biology
2 answers:
Naya [18.7K]3 years ago
7 0

Answer:

yes

Explanation:

all animals except coelenterates (radially symmetrical) and porifera (Asymmetrical) are bilaterally symmetrical

vazorg [7]3 years ago
4 0

Explanation:

Yes mollusks are bilateraly symmetrical

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
David is a collegiate track athlete, and his friend Tony is sedentary and overweight. At a party, they drink the same number of
dedylja [7]

Answer:

Option A

Explanation:

The rate and amount of decomposition of alcohol depends on the amount of body fat in an individual. The activity of enzyme alcohol dehydrogenase that breaks down alcohol is affected by concentration of body fat and water.  

The higher the body fat and the lower is the body water and fluid, the higher is the activity of enzyme alcohol dehydrogenase.  

Thus, the higher activity of enzyme alcohol dehydrogenase ensures higher rate of breakdown of alcohol due to which level of alcohol concentration in blood of  an individual reduces.  

Hence, option A is correct

6 0
3 years ago
Which air pressure reading would be most likely during a clear, sunny day?
Effectus [21]

the answer is option D.

7 0
3 years ago
1. Explain the function of white blood cells in the body.
Wittaler [7]

Answer:1. White blood cells are part of the body's immune system. They help the body fight infection and other diseases.

2. Red blood cells have adaptations that make them suitable for this.

3. The blood would not clot in case of an injury.

4. Blood supplies essential substances and nutrients.

Explanation: 1. White blood cells are able to recognize viruses and/or infectious germs, which is how they fight off disease/sickness. It is also why we have vaccines. Vaccines put either dead or weakened parts of a germ into your body. Then, the white blood cells recognize it and fight it off the next time it enters your body.

2. They contain hemoglobin, a red protein that combines with oxygen. They have no nucleus so they can contain more of the hemoglobin. they are small and flexible so that they can fit through narrow blood vessels.

3. This will lead to excess blood loss and can even lead to the death.

4. Such as as sugar, oxygen, and hormones to our cells. It also carries waste away from the cells, this waste is eventually flushed out of the body in urine, feces, sweat, and lungs.

3 0
3 years ago
The scatterplots indicate the population of rabbits in the population over time. The y-axis represents the number of rabbits and
soldi70 [24.7K]

Answer:graph a?

Explanation:

edge2020

4 0
2 years ago
Other questions:
  • Explain why a law is accepted as fact, but a theory is not.
    11·2 answers
  • Describe the pattern of evolution in primates. Is it linear?
    6·1 answer
  • Process in which chemical energy, instead of sunlight, is used to make "food"
    8·1 answer
  • What happens if a bacterial cell lands in a jar of jelly?
    11·1 answer
  • 20 Points!!!!!! William wants to create a cell model using ingredients in his kitchen. He uses plastic wrap to represent a vacuo
    12·2 answers
  • How many chromosomes will be left after meiosis
    10·1 answer
  • "Which statement concerning the oxygen level in the lake can be inferred from the graphs?
    9·1 answer
  • How do you comment on brainly? It never lets me
    6·2 answers
  • What are the advantages of Mempro ™ liposome technology?
    8·1 answer
  • Enzymes break down large molecules to yield smaller molecules.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!