1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
baherus [9]
3 years ago
9

What is the correct description of the components of an ATP molecule?

Biology
1 answer:
AveGali [126]3 years ago
3 0
<span>Option A. The correct description of the components of the ATP molecule is the following: the fundamental nucleotide in obtaining cellular energy, is formed by a nitrogen base linked to carbon and in turn, binds to the ribose which east linked to three groups of phosphate.</span>
You might be interested in
What three human systems interact when you are exercising?
ale4655 [162]

Answer: The respiratory system, the circulatory system, and the muscular system

Hope this helps :)

4 0
2 years ago
Which of the following actions acts to warm a homeothermic body?
uranmaximum [27]
Shivering

Explanation: shivering action is an act to warm a homoeothermic body. Sweating makes the body cool, panting don’t keep body warm and dilating blood vessels does not keep body warm instead constriction of blood vessels is the initial process to conserve body heat followed by waves of muscle contraction, which is nothing but shivering. Alteration of the set point in torpor is also not the right answer
4 0
3 years ago
How a polymer molecule is synthesised by glucose?
Kay [80]

Answer:

As a new covalent connection develops between the two glucose molecules, one loses a <em>H group,</em> the other loses an<em> OH group</em>, and a <u>water molecule is freed</u>.

<h2>Why does glucose form a polymer despite being a stable molecule?</h2>

The formation of glucose polymers (glycogen, starch, cellulose) requires the input of energy from uridine triphosphate (UTP). Any tiny molecules must be converted into bigger molecules, which is compatible with the second rule of thermodynamics. Building proteins from amino acids, nucleic acids from nucleotides, fatty acids and cholesterol from acetyl groups, and so on are examples. Energy is released when bigger molecules are broken down into smaller ones, which is compatible with the second rule of thermodynamics. Thus, glucose may be converted to CO2 and H2O, resulting in the production of ATP. While glucose is a tiny molecule and hence relatively "stable," it can exist at a potential energy level and may be used to build up (needs energy) or broken down (<em>produces</em> energy). All of these biochemical processes require the use of enzymes; otherwise, the activation energy of most reactions would require extremely long periods of time for random energy inputs to push the reactions in either direction, despite the fact that energy considerations favor spontaneous breakdown over synthesis.

5 0
2 years ago
Which statement is FALSE?
denis23 [38]

Answer:

It has to be D! cause there is no way that Hormones attach to special transport proteins.

Explanation:

That would be my guess?

6 0
3 years ago
What is the major function of the lymphatic system?
Norma-Jean [14]

Answer: d. return leaked fluids back to the cardiovascular system.

Explanation:

The lymphatic system is a web of vessels and tissues that transfers clear fluid that is called as the lymph. The lymphatic system spreads all over the body and filters and clean up the lymph, abnormal cells and pathogens. The filters traps the foreign particles from the blood. It also promotes the filtered fluid to reach back to the cardiovascular system and distribute to all the parts of the body in the form of blood.  

       

6 0
3 years ago
Other questions:
  • Which major tissue category includes tissues that function in secretion, absorption, and filtration?
    11·1 answer
  • Which of the following is NOT a characteristic that all living things share? A) a cellular organization B) using energy C) movem
    10·2 answers
  • How do mutations affect a species ability to survive and reproduce? Justify your response in two or more complete sentences.
    9·1 answer
  • The degree or intensity with which a particular genotype is expressed in a phenotype is its
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which best describes the practice of alchemy
    14·1 answer
  • What do you think could be done to minimizes people’s fears about genetic engineering?
    7·1 answer
  • 8. What is the sex (gender) of this karyotype?
    12·2 answers
  • Ayudaa
    15·1 answer
  • Part C: Short Answer<br> 1. Explain how a human body can maintain homeostasis.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!