1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
4 years ago
13

A(n) is a sequence of DNA nucleotides that codes for a specific protein or RNA molecule

Biology
2 answers:
hodyreva [135]4 years ago
8 0
Gene 
correct me if im wrong :)

hope this helpss!!

-BARSIC- [3]4 years ago
6 0
A codon is a sequence of DNA that codes for something
You might be interested in
Many scientists worked together to form a realistic model of the structure of the DNA molecule.
sleet_krkn [62]
I’m his major contribution to know the full structure of DNA.
7 0
3 years ago
When a sarcomere contracts and thin filaments move over thick filaments you would expect to see ________.
Lina20 [59]

Answer:

the I bands to appear smaller

Explanation:

I band is the lighter and a less dense area of the sarcomere. It contains no thick filaments. A Z disc passes through the center of each I band.  During muscle contraction myosin heads become attach to and slide along the thin filaments at both ends of a sarcomere. It pulls the thin filaments toward the M line and makes the thin filaments slide inward and meet at the center of a sarcomere. This inward movement of thin filament allows their ends to overlap.

As the thin filaments slide inward, I band and H zone narrower. I band and H zone become disappear altogether when the muscle is maximally contracted. The width of the A band and the lengths of the thick and thin filaments remain unchanged.

8 0
3 years ago
Which of the following is not a likely result of destruction of wetlands? A. healthy fish populations. B. decline in plant and a
FrozenT [24]

Answer: Option A) healthy fish populations.

Explanation:

Wetlands include swamps and marsh. i.e areas of land covered with water.

Once, wetlands are destroyed by human activities there would be:

- a reduction in the population of plant and animal that rely on its native organisms due to starvation.

- increased frequency of floods since excess water can no longer be collected there

- pollution of nearby streams​ as rain will wash off materials into them

However, healthy fish populations does not happen since producers like plankton eaten by the fishes are also destroyed.

Thus, healthy fish populations is the unlikely outcome

4 0
3 years ago
The rate of decay is called the _____.
BabaBlast [244]

Answer:

The half-life (t1/2) is the time taken for the activity of a given amount of a radioactive substance to decay to half of its initial value. The mean lifetime (τ, “tau”) is the average lifetime of a radioactive particle before decay. The decay constant (λ, “lambda”) is the inverse of the mean lifetime

6 0
3 years ago
What does the atom in Latin means​
vivado [14]
Atom in Latin is atomus which means the smallest particles
6 0
3 years ago
Read 2 more answers
Other questions:
  • Cells that contain formulas that refer to other cells are
    9·1 answer
  • How do deciduous trees in other parts of the world most likely respond to seasonal changes?
    7·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • DDT is a synthetic compound commonly used as an insecticide. It was used to control mosquito species that commonly spread diseas
    9·1 answer
  • (GIVING BRAINLIEST!!)
    7·1 answer
  • !PLEASE HELP AS SOON AS YOU CAN!
    8·2 answers
  • Which of the following statements about organelles is NOT true?
    13·1 answer
  • What is the name of this monomer ?
    6·1 answer
  • Explain how the model of inheritance for the orange fur trait causes
    5·1 answer
  • Which information can be determined from the chemical formula C6H12O6?; What is the correct formula for photosynthesis?; How are
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!