Answer:
Students who take a PE class and who will be eating sugary snacks before PE.
Explanation:
The control variable (or control group) is an experimental element which is constant or unchanged throughout the course of the experiment.
The option "students who take PE class and who will be eating sugary snacks before PE" will remain unchanged and constant because the whole point of the experiment is to see the effects on students performance in PE after eating sugary snacks.
Hope this helps :)
C...the key is that they are photosynthetic...so they produce oxygen (like plants)!
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer: papillary muscle
Chordae tendinae is a connective tissue that used to prevent the heart valve to be flapped away. It like a string that connected into the valve and makes it look like a kite. Papillary muscle is the part that anchoring it to the heart wall.