1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Klio2033 [76]
3 years ago
5

Which of the following is an INCORRECT association? View Available Hint(s) Which of the following is an INCORRECT association? c

hemiosmosis: ATP synthase glycolysis: glucose 6-phosphate the Krebs cycle: oxaloacetic acid electron transport: acetyl-CoA
Biology
1 answer:
stich3 [128]3 years ago
4 0

Answer:

The incorrect association is Electron transport chain:acetyl-CoA.

Explanation:

Chemiosmosis deals with synthesis of ATP by the catalytic activity of ATP synthase so this association is correct.

During glycolysis Glucose 6 phosphate is generated as the first product of this catabolic pathway so this association is correct.

Oxaloacetic acid is the end product of krebs cycle so this association is correct .

But electron transport chain has no relation with acetyl-CoA so this association is incorrect

You might be interested in
What tends to happen to the populations in the developing countries over time as the countries become more developed? *
ollegr [7]

Answer:

2

Explanation:

3 0
3 years ago
Which of the objects is producing the greatest force? PLEASE HELP GUYS!
Artemon [7]

Answer:

Raquetball

Explanation:

why because it is moving tthe least distance for lots of speed

3 0
3 years ago
Read 2 more answers
The presence of myelin allows an axon to
Reptile [31]
The presences of myelin allows an axon to conduct their signals rapidly
4 0
3 years ago
A h0m0zygous dominant brown mouse is crossed with a heterozygous brown mouse (tan is the recessive color). What percent will be
Vadim26 [7]

Answer:

75%

Explanation:

6 0
3 years ago
Read 2 more answers
Decreasing the saturation of the fatty acid chains on a particular type of phospholipid would result in the formation of _____.
Helga [31]

More fluid bilayers will be formed when the saturation of the fatty acids chains on a phospholipid is decreased.

Fatty acids are present in animals, plants and other microorganisms. They are composed of the carbon chain with carboxyl group at the end of the chain. The fatty acids are the vital components of the lipids, which are the essential fat soluble components. When the saturation level of these acids is decreased, it leads to the formation of more lipid bilayers.

Hence, the correct answer is 'more fluid bilayers'.

3 0
3 years ago
Other questions:
  • _________________ is a recessive genetic disorder that strikes young African-Americans and affects the hemoglobin in red blood c
    11·1 answer
  • What are the two types of natural resources?
    5·1 answer
  • Enzymes are proteins which reduce the _________________________ _____________________ required for a chemical reaction to occur.
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • 2.
    15·1 answer
  • Which of the following statements is false?Algae are used to make many commercial products, like marshmallows and paint.Algae ca
    15·1 answer
  • When a genetic mutation occurs, which part of the DNA changes?
    15·1 answer
  • Each statement explains a cause that would prevent a plant not to bear seed in its life cycle except:
    12·2 answers
  • Isometric training is ideal for immobilized rehab situations, they facilitate recovery and reduce muscle atrophy and strength lo
    9·1 answer
  • A student made the graph below to show the distance a toy car traveled over time.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!