Answer:
Nitrate
Nitrate is the form of nitrogen most used by plants for growth and development. Nitrate is the form that can most easily be lost to groundwater. Ammonium taken in by plants is used directly in proteins. This form is not lost as easily from the soil.
Explanation:
The garden plants and snails stay balanced as they are still being eaten. However, if the cat is removed, the birds will overpopulate and then the snail would be eaten and decrease faster which gives garden plants an increase in population due to the decrease in snails. Hope this helps!
Answer: False.
Meat is a good source of protein. There are nine essential amino acids which are required under special conditions like illness.
These are- Histidine, Leucine, Isoleucine, Valine, Threonine, Methionine, Lysine, Phenylalanine and Tryptophan. They cannot be synthesized by the body and therefore need to be taken from external protein sources.
Since meat contains all the essential amino acids, therefore it is considered as a good source of protein. Hence, the given statement is false.
<span>phenotype, genotype is the answer for the question above hope this will help.</span>
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
