1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
3 years ago
9

How are Eisenhower's leadership qualities as Supreme Commander of the Allied Forces on D-Day characterized?

Biology
1 answer:
yanalaym [24]3 years ago
5 0
President Eisenhower's leadership qualities as supreme commander of the Allied Forces on D-Day are characterized that he was experienced in leading complex battles and commanding diverse forces. The correct answer will be 2.  
You might be interested in
What is the role of diaphragm?​
Debora [2.8K]

Answer:

The role of the diaphragm is breathing

hope this helped you if it dose please mark brainiest

5 0
3 years ago
Read 2 more answers
A virus is
3241004551 [841]

Hello Issa16jah,

Your answer would be:

B. Always parasitic

Brainliest!?!


Hope this helps!


Have a nice day:)


~Rendorforestmusic

5 0
3 years ago
Read 2 more answers
Researchers set up a study to determine whether large doses of a nutritional supplement would shorten the length of time it take
Dafna1 [17]
The correct answer is (C)
3 0
3 years ago
Why are insulin levels in the blood an important marker for overall health in addition to cholesterol levels?
zvonat [6]
They are markers because their blood level can tell about the human's metabolism, and can predict diseases.

Cholesterol is a natural fat essential to the body. It allows, among other things, the synthesis of vitamin D or bile. It is a constituent of the wall of our cells. Finally, it is part of many hormones, such as sex hormones.Cholesterol has been identified as responsible for certain cardiovascular diseases such as myocardial infarction and stroke.
Insulin is a hormone naturally produced by the pancreas in response to an increase in the level of sugar (glucose) in the blood.Insulin synthesis failure or insulin resistance leads to diabetes, a disease that affects the quality of life of the patient as it will be dependent on daily intake of antidiabetic and insulin, and will be required to adapt a diet. dietetic
7 0
4 years ago
Read 2 more answers
Is adhd nature, nurture or a combination of both? Explain
PolarNik [594]

Nature not sure how to explain so sorry

5 0
3 years ago
Other questions:
  • Pre-australopiths experienced environmental cooling that, over thousands of years, converted large parts of their african habita
    8·1 answer
  • The hole in the spinal cord through which csf flows is the:
    10·1 answer
  • When you think of an organism changing its environment, you may think of large animals like humans that leave obvious signs of w
    15·2 answers
  • 4. If a bowl of fresh strawberries is sprinkled with sugar within a few minutes the berries are covered with juice, why? What do
    10·1 answer
  • Are food webs different to food chains? Explain why food webs are more<br> useful.
    8·1 answer
  • Explain why detritivores, decomposer<br>and omnivores are not assigned trophic level<br><br>level​
    8·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • 2. The immune systems is built of millions of cells called:
    6·2 answers
  • Insta pe add kro jo chaiye vo lo id== hanshu511​
    10·1 answer
  • 3. The nurse is caring for a patient with an MRI that reveals an embolic stroke in the temporal lobe. The nurse expects
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!