1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
3 years ago
11

Draw an atom showing and labeling the nucleus and the electron cloud

Biology
1 answer:
Elena-2011 [213]3 years ago
3 0

We can't really draw it for you, but the electron cloud is a thin shell around the atom, and the nucleus is the center. Hope this helps!

You might be interested in
Which is not a characteristic of homologous chromosomes?
Yakvenalex [24]

Answer:

C. exact same type of alleles

4 0
2 years ago
Question 2 (0.5 points) In the Northern Hemisphere, choose ALL that apply Summer solstice occurs when the Earth's North Pole is
adell [148]

Answer:

In North America, around June 21, Earth tilts on its axis toward the sun, which is Summer Solstice and when the Northern Hemisphere has the most daylight of any time of year. Winter solstice the Northern Hemisphere tilts the farthest away from the sun and when we have the least amount of daylight of any time of the year.

Explanation:

As Earth revolves around the Sun, it rotates on its axis. Sometimes Earth tilts toward the Sun which is when Summer occurs. In the Winter Earth tilts away from the Sun.

8 0
2 years ago
Read 2 more answers
WILL GIVE 90 POINTS
torisob [31]

Answer:

\small\mathfrak\green{a.infectious \: disease} \\  \\ \small\mathfrak\purple{hope \:  it \:  helps...}

5 0
3 years ago
DNA<br>"Deoxyribonucleic<br>Acid"​
Zarrin [17]

Answer:

Details about DNA are given in the explanation section. Hope it will be helpful for you.

Explanation:

DNA, or deoxyribonucleic acid, is the hereditary element in humans and almost all other organisms. Nearly every cell in a person’s body has the same type of DNA. Most DNA is found in the cell nucleus (nuclear DNA), but a small quantity of DNA can also be found in the mitochondria (mitochondrial DNA or mtDNA).

The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same type in all people.

DNA bases pair up with each other, A with T and C with G, to form units that are called base pairs. Each base is also attached to a sugar molecule and a phosphate molecule.  A base, sugar, and phosphate are called a nucleotide. Nucleotides are arranged in two long strands that form a spiral called a double helix.

A valuable feature of DNA is that it can replicate, or make copies of itself. Each strand of DNA in the double helix can serve as a pattern for duplicating the sequence of bases.

7 0
3 years ago
Red blood cells,carrying dioxide(a waste product of cellular respiration) travel in the blood vessel to the lung; to get rid of
alexandr1967 [171]

Answer:

True.

Explanation:

Red blood cells or erythrocytes carry oxygen to the cells of the body so that they can have energy and function properly. This is not the only function of red blood cells. Also, they carry dioxide, which is a waste product that needs to be out of our body. Erythrocytes carry the dioxide to the lungs, specifically to the alveoli. In the alveoli due to the inhalation, oxygen enters our body traveling up to the lungs, specifically to the alveoli, where thanks to the thin wall of it as well as the one on the capillaries that are in contact with it, the dioxide enters the lungs to be expelled in the exhalation, and the oxygen is taken by the red blood cells to be used in the cellular respiration and generate energy to keep the vital functions of our body.

3 0
2 years ago
Other questions:
  • How does leaf structure facilitate photosynthesis
    15·2 answers
  • The half-life of a radioisotope is the amount of time it takes for
    13·2 answers
  • An unknown substance is dissolved in water. The solution is corrosive,conducts electricity, and has a higher concentration of H+
    13·1 answer
  • Organisms with overlapping niches probably have which type of relationship?
    10·1 answer
  • Both molecules and compounds are made up of
    5·1 answer
  • Why is biodiversity important in a marine ecosystem
    7·1 answer
  • Which best describes the process of conduction?
    10·1 answer
  • Which parasites are contrasted in the chart below?
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Catabolism of food molecules involves ________. group of answer choices glycogenesis dehydration reactions synthesis reactions h
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!