1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eimsori [14]
3 years ago
5

Which pair correctly associates a physiological process with the appropriate vitamin? question 5 options:

Biology
1 answer:
gayaneshka [121]3 years ago
6 0
The answer is B.Normal vision and Vitamin A
You might be interested in
What happens to the water supply when icecaps and glaciers are formed? Water increases. Water decreases Water changes to gas. Wa
grandymaker [24]

Answer:

Water volume remains the same.

Explanation:

Ice formation is a phase change from liquid to solid.  The ice is less dense so its volume gets larger.  Warm it up, melt the ice and it will return to the same volume it had as a liquid.

6 0
3 years ago
When an object starts moving on it’s one, potential energy becomes kinetic energy.
mote1985 [20]

Im confused about the question can you explain

4 0
3 years ago
Which of the following best explains the factors that led to the dust bowl?
zubka84 [21]
Ithe answer is b. and the temperature brought fires to the crops. One movie example of this could be the intersteller.
7 0
4 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
PLS ANSWER QUICK What do you think would happen to each species if the water became too cloudy for sunlight to penetrate?
Vaselesa [24]

Answer:      Turbidity blocks the sunlight that plants need to produce oxygen for fish and other aquatic life. ... One effect is an increase in rooted aquatic plants, since sunlight can now penetrate to greater depths.

Explanation:

3 0
3 years ago
Other questions:
  • What is the function of the organelle identified in the picture? A) movement B) houses the cell's DNA C) houses the digestive en
    6·1 answer
  • Explain what the line plot on a climate diagram shows
    13·1 answer
  • Explain what happens inside your body as you give an oral report in front of your class
    10·1 answer
  • There are at least 900 different nutrients, which are nonnutritive compounds in plant foods. 2. includes a set of disease preven
    10·1 answer
  • Which line from Chaucer’s “General Prologue" to The Canterbury Tales is a reference to the feudal social structure of medieval E
    12·1 answer
  • Which of the following is correct about the flatworm's muscular system ?
    5·2 answers
  • Endocytosis brings large particles ​
    11·1 answer
  • Which of the following do scientists think is responsible for climate change?
    15·2 answers
  • How would human population be if crossing over did not happen during meiosis
    7·1 answer
  • Mutations within the dna sequence of an organism can​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!