1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amiraneli [1.4K]
3 years ago
10

Chromosome is to cactus as gene is to _____.

Biology
1 answer:
alexgriva [62]3 years ago
3 0
Chromosome is to cactus as gene is to needle 
You might be interested in
Some slime molds have some morphological similarities to fungi such as during times of stress they will develop into fruiting bo
gayaneshka [121]

Answer:

The correct answer will be option - D.

Explanation:

Slime moulds are the fungus-like protists which bear a structure called sporangium which produces spores.  The sporangium is produced in fungi as well due to which these protists are called fungus-like.  Although both produce sporangium but they are not closely related, rather they are distantly related organisms.

The appearance of a sporangium in both indicates that they had faced the same conditions due to which they both showed the same adaptation by producing the same structures performing the same function. In evolutionary terms, this is an example of convergent evolution.

Thus, option D is the correct answer.

5 0
3 years ago
Microscopic plants called algae grow inside the top layer of sea ice in the Antarctic if enough sunlight reaches that layer of i
MrRa [10]

Answer:

The correct answer is: (A).

Explanation:

  • In the question, it is mentioned that the algae can grow under the conditions of "enough sunlight" and "enough nutrients".
  • Sunlight reaches the algae, by first falling on the surface made up of ice and snow and then refracting from there into the top layer of the ice where the algae grows.
  • However, the capability of both snow and ice to reflect sunlight is far more than that of refracting sunlight.
  • Therefore, the amount of light received by the algae is similar in absence or presence of the layer of snow on the top layer of ice.
  • However, on deposition of snow on the layer of the ice, the weight of the ice increases and it sinks below into sea water.
  • This allows more nutrient rich sea water to percolate into the ice and reach the algae.
  • The algae receive more nutrients from the sea water and hence is capable undergoing better metabolism and growth.
  • Hence, more algae are produced under such a situation.
5 0
3 years ago
When matter from plants and animals decay, microorganisms responsible for the decomposition process respire. Is that photosynthe
n200080 [17]
In Nature's rule of law; it is technically both. The only difference between the two would be photosynthesis happens with plants. While cellular respiration happens with living beings.
8 0
3 years ago
Read 2 more answers
If. by examining your family history and DNA, you could tell how long you would
ycow [4]

Answer:

i need points

Explanation:

points

8 0
3 years ago
Which best describes the reactants and products of photosynthesis?
Alona [7]

Answer:They are the same, and the products of cellular respiration reflect the reactants of photosynthesis

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • A cladogram is shown below.
    13·1 answer
  • The left side of the brain controls the left side of the body
    8·1 answer
  • Can some one help me out please
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How would you describe the relationship between the two variables?
    13·1 answer
  • The color distribution for a specific population of lizards is 170 blue, 50 turquoise, and 30 green. a. The allele for the color
    8·1 answer
  • A student has gone into cardiac arrest, meaning her heart has stopped beating. What would be the consequence for her
    12·2 answers
  • Hii! Please help me on this question!
    7·2 answers
  • Which of the following is NOT a risk factor for HIV/AIDS?
    12·1 answer
  • Which of the following happens during interphase?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!