1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Morgarella [4.7K]
3 years ago
13

Atoms are the smallest unit of non-living things and ______ are the smallest unit of living things.

Biology
2 answers:
oksano4ka [1.4K]3 years ago
3 0
Atoms are the smallest unit of non-living things and CELLS are the smallest unit of living things.
Ilya [14]3 years ago
3 0

Answer:

cells

Explanation:

i just took the test

You might be interested in
What role does nitrogen play in living organisms
Andru [333]
I believe it is amino acids?
5 0
4 years ago
Read 2 more answers
Plz help I’ll make you brainliest if correct
3241004551 [841]

Answer:

it would be C, since an abiotic factor is a non-living thing that helps shape the ecosystem.

Explanation:

If you look at A it lists flowers, which are alive. If you look at B it lists bacteria, which is alive. C doesn't list anything thats alive. D lists insects, which are alive.

7 0
3 years ago
Read 2 more answers
Which of the following epithelial tissue types is NOT correctly matched to its function?A. stratified squamous epithelium; absor
olga2289 [7]

Answer:

A. stratified squamous epithelium; absorption

Explanation:

Stratified squamous epithelium are composed of multiple layers of cells which rest on a basement membrane. Superficial layers are made of squamous cells and underlying layers can also be made of cuboidal or columnar cells.

Stratified squamous epithelium  is generally present in area where there is frequent physical or chemical abrasion. It protects the underlying structures from the stress. Hence, it is found wherever the body comes in contact with the outer environment like skin, digestive system and respiratory system. It also prevents water loss and desiccation.

6 0
3 years ago
Why are single-stranded binding proteins necessary for DNA replication?
Margarita [4]

Answer:

d.They prevent the two parental strands from coming together again.

Explanation:

During the process of DNA replication, the two DNA strands should be separated from each other to serve as a template. To separate the two DNA strands, the helicase enzyme breaks down the hydrogen bonds between the complementary base pairs of the DNA strands. The process uses ATP as a source of energy.

Due to the presence of complementary base pairs, the separated DNA strands have a tendency to reanneal by the formation of hydrogen bonds. To prevent the reannealing of separated DNA strands, single stranded binding proteins bind to them. Binding to single stranded binding proteins to the separated DNA strands does not allow them to reanneal.  

8 0
3 years ago
Runner is a protein that can be used for cellular movement. The runner protein in white blood cells is 140 amino acids long whil
natta225 [31]

Answer:

There is alternate splicing of the runner mRNA.

3 0
3 years ago
Other questions:
  • How are igneous rocks created
    11·2 answers
  • Which of these is an environmental change that occurs rapidly?
    13·2 answers
  • Which sentence best describes a cell that is isotonic for a substance?
    12·2 answers
  • Why do scientists use controlled experiments
    11·1 answer
  • My question says for the word search (8 words with an e to second to last) "This type of organism uses light energy to make chem
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Evaluate the extant to which the government has contributed to.social grants​
    10·1 answer
  • 43. Chordata are
    9·2 answers
  • Somebody help me please
    8·1 answer
  • Louisiana has a variety of natural resources that are important for human life.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!