1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
9

MEDAL!

Biology
1 answer:
Anton [14]3 years ago
8 0
The over-hunting of the Baleen Whales lowers the population significantly. Since Baleen Whales eat the penguins, less whales equals less penguins eaten; therefore the penguins' population remains about the same until breeding season, where a surplus of baby penguins are produced.
You might be interested in
Cells are grouped by the ______ they do
denis23 [38]
Structure and function-there are only TWO types of cells-prokaryotic and eukaryotic

8 0
3 years ago
What are all the things that are kept the same in a experiment
muminat

Answer:

Explanation:

The things that are changing in an experiment are called variables. A variable is any factor, trait, or condition that can exist in differing amounts or types. An experiment usually has three kinds of variables: independent, dependent, and controlled

7 0
3 years ago
Read 2 more answers
1. Describe DDT and summarize the history of the use and banning of DDT, including actions taken by the U.S. government. State t
igomit [66]

DDT stands for  dichloro-diphenyl-trichloroethane. The first kind of synthetic/artificial insecticides came into use in the 1940s. The earlier usage of DDT include:  a) Killing of malarial vectors, b) Combatting Typhus and other insect borne human diseases, c) As a pest control in crops d) as a pest control in garden, live stock production and even at homes.  

The negative impact of DDT could be felt for the first time when the pests that were earlier killed by use of DDT have now become pesticides resistant. In the 1950s in USA, the regulatory measures were adopted to reduce the usage of DDTs as its effects as a pesticides were no more long significant and also it was creating detrimental physical and psychological impacts on the human and environment.

It was in 1972 that the U.S. Environmental Protection Agency cancelled the order for banning the usage of DDT based on the adverse impact it produced on the environment, human and other life forms. Since then continuous studies are being conducted to analyse the impact of DDTs. In some later years it was established that DDT is the cause of producing tumors in liver.  

Some of the common negative impacts produced by DDT as per the U.S. Department of Agriculture :  

a) The non destructive nature – DDT can not be destroyed and thus it remains persistent in the atmosphere

b) It attacks the tissues of living organisms especially the animals and humans  ( fatty tissue)

c) It can penetrate the atmosphere to deeper extent.

Now as per the current stuation, The use of DDT is controlled and other alternatives of pest control organisms is being deduced. As per the treaty of Stockholm Convention on POPs (Persistent organic pollutants) , usage of DDT for malarial control is justified but it puts a restrictive use of DDT as pesticides in other areas.  

4 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Is the only effective way invertebrates fight disease.
zepelin [54]
Phagocytosis is the only effective way invertebrates fight disease
6 0
2 years ago
Read 2 more answers
Other questions:
  • An organism that contains two different alleles for a trait is said to be _______ for that trait.
    9·1 answer
  • Which one is correct?
    15·2 answers
  • Over time, a plant pollinated by a hummingbird has developed very long, tube-like flowers. Why might the flower have adapted in
    14·1 answer
  • Help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Me Will give 100 points. Only for the 2nd one
    15·2 answers
  • Police bring a client with substance abuse to the ed after being arrested for a domestic dispute in which he gave his wife a bla
    10·1 answer
  • What is the one part of the nucleotide that differs among the other different nucleotides?
    15·2 answers
  • Global estimates of species richness are likely to be best for which of the below taxa?
    7·1 answer
  • Which of these species is not endangered today thanks to successful conservation efforts?. . A) bald eagle. B) polar bear. C) Be
    11·2 answers
  • Carbon cycles through the biosphere in all of the following processes EXCEPT
    14·1 answer
  • A woman is admitted to the labor suite with contractions every 5 minutes lasting 1 minute. she is postterm and has oligohydramni
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!