Answer:
GAAUUGUGGGGACUGAAGCGCGGCAGC
Explanation:
The process whereby a mRNA molecule is formed from a DNA template is called TRANSCRIPTION. The mRNA formation follows the complementary base pairing rule which says that Adenine is bonded to Thymine (Uracil in RNA) i.e A-T(U) while Guanine is bonded to Cytosine i.e. G-C.
Based on this, a DNA molecule with base sequence: CTTAACACCCCTGACTTCGCGCCGTCG will be transcribed into a mRNA strand with base sequence: GAAUUGUGGGGACUGAAGCGCGGCAGC
Answer:
That foxes, wolves, and Dingoes have a common ancestor they all share but, however each species branches off because of evolution.
Answer:
Inward and counter-clockwise.
Explanation:
In the northern hemisphere, pressure gradients and the coriolis effect applied to low pressure centers produce winds that blow inward and counter-clockwise while on the other hand, high pressure centers of northern hemisphere blow outward and counter-clockwise. Inward and clockwise blow of wind occurs in the southern hemisphere of the earth.
Answer: C) extensive satellite systems
Explanation: Jupiter, Saturn, Neptune and Uranus are called Jovian planet. They are mostly characterised by what they are made up of, which is mainly gases (Hydrogen and Helium). They have so solid surface and are much larger in size compared to the terrestrial planet (Earth, Mars, Venus, Mercury). Jovian planet are very far away from the sun and they have extensive satellite system i.e they have a combined 166 number of moons in their orbit. Because of their sizes, they easily capture wandering objects into their orbits permanently or semi-permanent.