Answer:
Prions causes abnormal folding of the prion proteins in the brain.
Explanation:
Prions are the abnormal infectious agents composed only of the proteins and no nucleic acids. The prions cause several neurodegenerative diseases in the humans as well as the mammals.
The prions cause the cow mad disease in the cows by affecting the brain of the cow as the prions act on the prion proteins present in the brain only and change their conformation. This leads to the degeneration of the neurons and causes tiny pores in the brain giving sponge-like appearance.
This slows down the mental activity and thus ultimately leads to the death of the cow.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
A species with a wide range of tolerance can dominate most habitats due to its ability to adapt.
<h3>What is a wide range of tolerance?</h3>
A wide range of tolerance is the ability for an organism to tolerate low or high levels of abiotic contamination in it's natural habitat. This means that the organisms in question show a high level of adaptability and are able to survive in hostile environments. This allows them to remain dominant in most habitats despite contamination values.
Therefore, we can confirm that a species with a wide range of tolerance can dominate most habitats due to its ability to adapt.
To learn more about contamination visit:
brainly.com/question/15964651?referrer=searchResults
Answer:
Osmosis is responsible for the ability of roots to draw water from the soil. Plants concentrated solutes in their root cells by active transport and water enters the roots by OSMOSIS. Osmosis is also responsible for controlling the movement of guard cells
Answer:
Am I supposed to tell you if it's right or wrong? or what...??
Explanation:
