1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notsponge [240]
3 years ago
14

When a species no longer exist it is said to be

Biology
1 answer:
Sedbober [7]3 years ago
4 0
I think the answer is :extinct
You might be interested in
You are studying a population of mice that fall into two size classes: small and large. You are curious if mouse size is under s
Morgarella [4.7K]

Answer:

The information is not sufficient to support this asumption

Explanation:

To unequivocally determine the existence of selection acting on this trait (size), it is necessary to carry out an experiment in which the sample size should be statistically significant (N sample for each group > 50). Moreover, it is also important to include negative controls (i.e., individuals with an average size between both groups) in the experiment.

8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What shows relationship between ancestors and their descendants
aalyn [17]
The biological term is a pedigree.
4 0
2 years ago
Read 2 more answers
Describe how eukaryotic plant cells store and remove waste.
sergiy2304 [10]
Because havee a especial character who acn do thant

3 0
3 years ago
What does data mean for people involved in farming and agriculture?
lara31 [8.8K]

Answer:

paleolithic went to neolithic and thats when the people started to build homes and boats etc

Explanation:

6 0
3 years ago
Other questions:
  • Which pair of organisms represent a predator-prey relationship?
    13·1 answer
  • Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work afte
    14·1 answer
  • Does chromosome number appear to correlate to the type of organism?
    5·1 answer
  • A police officer felt a soft lumpy object in a suspects back pocket, about the size of a quarter. He was unsure what it was, so
    15·1 answer
  • Are blue stars young or old how can you tell
    10·1 answer
  • Grasses and scattered trees adapted to a tropical wet and dry climate
    15·1 answer
  • 2.Exocrine glands such as sweat glands secrete fluids through ducts.
    11·2 answers
  • What does water vapor need in order to condense?
    12·1 answer
  • If three out of four Cubs from the cross had sandy-colored fur, the allele for sandy-colored fur was? -dominant. -recessive. -mo
    8·1 answer
  • Of the following cells, the only one to have the haploid number of chromosomes is a(n)
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!