1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
11

9. Many naturalistic writers were influenced by Darwin's theory of evolution and believed _______ and social environment contrib

uted greatly to a person's overall character.
Biology
1 answer:
OlgaM077 [116]3 years ago
6 0

Charles Darwin's evolutionary theory enables us to establish cause and effect in biology, including those associated with a person's overall character. The evolutionary biologist Theodosius Dobzhansky wrote: "Nothing in Biology Makes Sense Except in the Light of Evolution". It's a well-known statement on the evolutionary theory and their implications in all spheres of biology

You might be interested in
What aspect of chromosome behavior most clearly accounts for Mendel's law of segregation?
svetlana [45]

The given question is incomplete as the group of choices lack the correct answer, however, the correct group of choices are as follows:

A. Movement of sister chromatids to opposite poles at anaphase II of meiosis.

B. Movement of homologous chromosomes to opposite poles at anaphase I of meiosis.

C. Crossing over between homologous chromosomes during prophase I of meiosis.

D.  Replication of chromosomes prior to meiosis.

E. Independent alignment of different homologous pairs on the metaphase I spindle.

Answer:

The correct answer is :  Movement of homologous chromosomes to opposite poles at anaphase I of meiosis.

Explanation:

The Mendel's law of segregation says that during formation of gametes the copies of genes segregate from each other so each gamete has equal and only one allele of the gene.

This behavior of homologous chromosome can be seen in anaphase I in meiosis, responsible for the segregation of copies of allele into different copies.

Thus, the correct answer is :  Movement of homologous chromosomes to opposite poles at anaphase I of meiosis.

7 0
3 years ago
What are the tool used to look at the basic structure
densk [106]

Answer:

Documentation,link section ,definition section ,main function ,etc

5 0
3 years ago
In two or more complete sentences, explain the responses of vomiting and fever. Be sure to state the stimuli that cause the resp
Jobisdone [24]

Answer:

I am so sorry if this is too late but your answer is in the explanation.

Explanation:

Weakness and nausea are the responses of vomiting and fever. Because people tend to feel weak and uneasy after vomiting. Body temperature also increases resulting headache and body cramp.

       The stimulus that causes he response is coldness and weakness. And the purpose of the response of a fever is that it raises the body temperatures so that the bacteria and germs that causes the fever get kill or destroy that are sensitive to temperature changes.

8 0
3 years ago
What is the role of auxin in plants​
Sophie [7]

Answer:

Auxin is a key regulator of plant growth and development, orchestrating cell division, elongation and differentiation, embryonic development, root and stem tropisms, apical dominance, and transition to flowering

Explanation:

Hope this helps you

3 0
3 years ago
Read 2 more answers
A Labradoodle is created by scientist to be hypoallergenic but still look like a labrador
Alla [95]

Answer:

whoa there holy cow

Explanation:

SJJKAOKPMADJO*imnotanalien*NNKSNK

6 0
3 years ago
Read 2 more answers
Other questions:
  • Punnett squares are used to show possible combinations of alleles or to predict the probability of a trait occurring in offsprin
    10·2 answers
  • This is an organisms that breaks down and gains nutrients from dead organisms
    15·1 answer
  • Based on your test results, the cocaine was cut with which substance?
    8·1 answer
  • Compare primary and secondary succession
    15·1 answer
  • Complete the statement with the correct word.
    5·1 answer
  • HELP ASAP!!!! 50 points!!
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Use the information extracted from the figure below to answer the following question.
    8·1 answer
  • Please Answer FAST ASAP
    12·2 answers
  • During the cell cycle, proteins called cyclins bind to enzymes that send signals for the cell to progress through stages of cell
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!