All categories

4 years ago

PLEASE HELP ASAP!!

2 answers:

5 0

How are the dark reactions that occur in plants dependent on the light reactions?
a.The chemical energy used in the dark reactions is produced in the light reactions.

Photosynthesis is divided into two parts.
1) Light - dependent reaction
2) Light - independent reaction

Light dependent reaction absorb energy from the sun to produce ATP and NADPH, these energies are used in the light-independent reaction. The ATP provides the energy, while the NADPH provides the electrons required to fix the carbon dioxide into carbohydrates.

inessss [21]4 years ago

3 0

yes the answer is a hope it helps

You might be interested in

Question 13 (2 points)

lyudmila [28]

The answer is B. Morphogenesis

6 0

4 years ago

Read 2 more answers

What is the mRNA that would be transcribed from this strand of DNA?

Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0

2 years ago

What is the main driving force for surface ocean currents?

Anna35 [415]

Answer:

D) friction between wind and surface water

Explanation:

I believe

7 0

3 years ago

Read 2 more answers

The rate of species loss has ____ dramatically since the onset of the industrial revolution.

Igoryamba

Has increased dramatically. this because industrialization has resulted in released of global warming gases that have consequently led to global warming i.e increase in temperature to the levels that some species cannot survive. in addition industrialization has led to increased demand of energy which has led to mining of energy sources such as coal. this mining has resulted to destruction of habitat of some animals and and plants leading to extinction of some.

8 0

3 years ago

1. What is the term that refers to the change that happens in a living organism because of a stimulus?

Studentka2010 [4]

Answer:

The answers are :-

1.What is the term that refers to the change that happens in a living organism because of a stimulus?

c) stimulus

2. The best example of an organism's response to a stimulus.

d) dog barks when there are fireworks.

3. The process by which living organisms stay the same.

b) homeostasis

4.How does a one-celled organism grow?

c) It divides

PLZZ MARK ME AS BRAINLIEST 

4 0

3 years ago