1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
3 years ago
15

Which of the following is a correct statement about ecosystems. Energy and matter flow in one direction only. "Energy flows in o

ne direction, matter recycles." Matter flows in one direction while energy recycles. Energy and matter both recycle repeatedly.
Biology
1 answer:
densk [106]3 years ago
4 0

Answer:

"Energy flows in one direction, matter recycles."

Explanation:

Matter "returns" to the environment by the deutucators. Energy comes from the sun and is transmitted to higher trophic structures.

You might be interested in
Early observations of a cultured cell line indicated that the cells did not exhibit either density-dependent inhibition or ancho
pentagon [3]
The cells show characteristics of tumors.  

Tumor cells have the ability to grow and proliferate in absence of adhesion or anchoring. This is particularly helpful during metastasis when a cancer cell travels through the bloodstream to another location.
<span>
A cancerous cell has a number of mutations that regulate cell division. In addition, they exhibit impairment in DNA repair system. Therefore, cancer cell divided fast. Since the DNA repair system is nonfictional, the cells do not pause division to repair the mutation.</span>
6 0
3 years ago
The conditions that surround someone or something. These conditions and influences affect the growth, health, progress, etc., of
Likurg_2 [28]

Answer: Enviroment

Explanation: Environmental factors or conditions influences growth, health

3 0
3 years ago
Read 2 more answers
Does adding fertilizer affect the growth of a plant?
lawyer [7]

Answer:

Adding fertilizer makes the growth speed of a plant faster.

Independent: Fertilizer

Dependent: Growth of plant

Control: How much fertilizer

Explanation:

I think that's the answer. I hope this helps :)

4 0
3 years ago
If a cell were placed in an anaerobic environment which organelles would be unable to function
vodka [1.7K]

chloroplasts is an organelle that actually carry out the photosynthetic activity will be unable to function if placed in a dark environment.
3 0
3 years ago
Compounds that give color and taste to foods are called _____. a. proteins b. toxins c. lipids d. phytochemicals e. fibers
Mandarinka [93]

<u>Phytochemicals</u> are the compounds which gives color and taste to the food.

Explanation:

Phytochemicals are chemicals which occur naturally in plants which enhance taste or color when added to food. They are commonly found in vegetables, fruits, whole grains, nuts, seeds and beans.  

These are the unique chemicals that give carrots their bright orange color, the searing hotness to the peppers, the bright blue color to the blueberries, the unique flavor to onions, etc.  

There are many types of phytochemicals like carotenoids (carrots), flavinoids (apple), anthocyanins (berries), polyphenols (tea), reservatrol (wine), sulfides (onion), isothiocyanates (cabbage), quercetin (apple), proanthocyanidins (grapes), terpenes (cherries), leutins (green leaves) etc.  

Phytochemicals are natural chemicals which behave like antioxidants and prevent many diseases like cancer.

5 0
3 years ago
Other questions:
  • A client is admitted with a diagnosis of schizotypal personality disorder. Which characteristic would this client exhibit during
    11·1 answer
  • What organism is needed for protein synthesis??
    7·1 answer
  • What are the factors that influence the ocean’s chemistry?
    10·1 answer
  • PLEASE HELP ASAP!
    13·1 answer
  • What are the main sources of carbon dioxide in the<br> atmosphere?
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Does grain size determine the porosity of a sediment type?
    9·1 answer
  • System that is responsible for the procreation of a species
    15·1 answer
  • Explain why interactions between organisms are important.
    12·1 answer
  • Khalil is an investment underwriter who researches new funds to see if they will be profitable without causing a huge risk to th
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!