1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uysha [10]
3 years ago
13

Identify the factors of 9x2 + 24x + 16.

Mathematics
2 answers:
lana [24]3 years ago
5 0

Answer:

A

Step-by-step explanation:

12x+12x=+24x

24x is equal to the middle value

vagabundo [1.1K]3 years ago
4 0
Answer:
A- (3x+4)(3x+4)
You might be interested in
Find the volume of a cone with a height of 7yd and a base diameter of 6yd . use the value 3.14 for π , and do not do any roundin
yarga [219]
I think the volume of the cone is 65.94yd because the radius is 3 and the height is 7 also 3 to the second power equals 9 then 3.14 multiplied by 9 equals 28.26 and finally 28.26 multiplied by 7/3 equals 65.94

V=3.14 x r^2 h/3
V=3.14 x 3^2 7/3
3 0
3 years ago
Find the mode and range of each data set:<br><br> C) 86.4,87.2,95.7,96.4,88.1,94.9,98.5,94.8
den301095 [7]
Mean: 92.75

Median: <span>94.85

Mode: </span>86.4, 87.2, 95.7, 96.4, 88.1, 94.9, 98.5, 94.8

8 0
3 years ago
Read 2 more answers
Help with 19??????????
Luba_88 [7]

Adding Integers

If the numbers that you are adding have the same sign, then add the numbers and keep the sign.

Example:

-5 + (-6) = -11

Adding Numbers with Different Signs

If the numbers that you are adding have different (opposite) signs, then SUBTRACT the numbers and take the sign of the number with the largest absolute value.

Examples:

-6 + 5= -1

12 + (-4) = 8

Subtracting Integers

When subtracting integers, I use one main rule and that is to rewrite the subtracting problem as an addition problem. Then use the addition rules.

When you subtract, you are really adding the opposite, so I use theKeep-Change-Change rule.

The Keep-Change-Change rule means:

Keep the first number the same.

Change the minus sign to a plus sign.

Change the sign of the second number to its opposite.

Example:

12 - (-5) =

12 + 5 = 17

Multiplying and Dividing Integers

The great thing about multiplying and dividing integers is that there is two rules and they apply to both multiplication and division!

Again, you must analyze the signs of the numbers that you are multiplying or dividing.

The rules are:

If the signs are the same, then the answer is positive.

If the signs are different, then then answer is negative.

6 0
3 years ago
Which values of k would cause this system of equations to have no solution? Check all that apply.
xeze [42]

Answer:

x= -2y/3

-4y+4y=14

0y= 14

This has no solution.

Step-by-step explanation:

Answer In cases of two equations having two unknown variables the simultaneous method of solving the equations is adopted.

Supposing “0” as the value of “k” we will have the equation as 3x+2y=0

Then separating variable x will give, x= -2y/3

Substituting the value of x into the first equation that is: 6x + 4y = 14

6(-2y/3)+4y=14

Expanding this we get: 6(-2y/3)+4y=14

-4y+4y=14

0y= 14

Thus, no solution.

5 0
3 years ago
Read 2 more answers
4. In the accompanying diagram, AABC – ADEF, DE = x + 2, DF = x+8, AB = x-3, and AC = x. Determine, algebraically, the value of
alexira [117]
Danggg that is sooo longgg I feel bad for you
3 0
3 years ago
Other questions:
  • Is my answer correct?
    10·1 answer
  • A clock on sale for $215 was regularly priced at $565 find the percent of discount
    15·1 answer
  • 5/8m-3/8=1/2m+7/8 how do you solve this. variables on both sides. STEP BY STEP PLEASE!!!!!!!!!
    12·2 answers
  • A box has a length of 5 cm, a width of 10 cm, and a height of 2 cm. The volume of the box is
    8·1 answer
  • X-4/10=7/5<br> Plz solve these
    10·2 answers
  • Which is greater 36km or 36000m
    9·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • A rectangle a photo with dimension 3 inches wide by 4 inches long is enlarged to a length of 12 inches what is the width of the
    15·1 answer
  • Please help me! Thank you!
    5·1 answer
  • A 12 foot ladder leans against a building. The angle of elevation from the ground to the foot of the ladder is 46°. Find, to the
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!