All categories

2 years ago

What happens when lakes are acidified?

1 answer:

5 0

Lakes that have been acidified cannot support the same variety of life as healthy lakes. As a lake becomes more acidic, crayfish and clam populations are the first to disappear, then various types of fish. Many types of plankton-minute organisms that form the basis of the lake's food chain-are also affected. As fish stocks dwindle, so do populations of loons and other water birds that feed on them. The lakes, however, do not become totally dead. Some life forms actually benefit from the increased acidity. Lake-bottom plants and mosses, for instance, thrive in acid lakes. So do blackfly larvae.

You might be interested in

How have increased carbon dioxide levels and temperatures affected living organisms?

Bezzdna [24]

Answer:

Explanation: Carbon dioxide increases temperatures, extending the growing season and increasing humidity. Both factors have led to some additional plant growth. However, warmer temperatures also stress plants. With a longer, warmer growing season, plants need more water to survive.

7 0

3 years ago

Read 2 more answers

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

2 years ago

The data below was collected in the field while studying the effect of pH on the growth of

never [62]

Answer: Answer is c 8 500

Explanation: Find the growth, in this case it would be 4-12. So you want to find the difference between them by subtracting the two values. 12-4=8

8 0

2 years ago

What is happening to the [OH-] when the solution turns from pink to violet?

motikmotik

Answer:

the hydroxide ions are undergoing ionization and the particles are gaining / losing electrons .

Explanation:

i think it is because ::

the phenolphthalein of the solution has gone from having a pH of around 8 (pink) to being alkaline at above 10 which causes it to burn purple / violet .

5 0

2 years ago

Can you identify the ploidy of different structures?

svetlana [45]

Answer:

The sporophyte generation is (diploid).

The gametophyte generation is (haploid) .

The embryo is (diploid) .

The megaspore is (polyploid) .

Explanation:

These shows cell division before recombination of gamete.

4 0

2 years ago