1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dennis_Churaev [7]
2 years ago
15

She doesn't know the whole course because she was absent the day we were learning this so, she needs more help!! (My friend)

Biology
1 answer:
Olenka [21]2 years ago
8 0
Answer The gravity and the sun


Have a good day
You might be interested in
Particles closest together in which state of matter
IRINA_888 [86]
The correct answer is Solid.
6 0
2 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
2 years ago
Why haven’t there been large earthquakes in hundreds of years at the Marianas Trench
kumpel [21]

Answer:

asks r

Explanation:

jwjwjenennrjdjejemendjdjsjwmendndbdbdhf CV eneneisieieurbrnrjeud82uj2jekejejej3 so yea

4 0
2 years ago
Definition of Uniformitarianism
Shkiper50 [21]

Answer:

the theory that changes in the earth's crust during geological history have resulted from the action of continuous and uniform processes.

Explanation:

6 0
3 years ago
______ immunodeficiency diseases are present at birth and usually stem from genetic errors, whereas _______ immunodeficiency dis
Anni [7]

Answer:

primary, secondary

Explanation:

primary immunodeficiency diseases are present at birth and usually stem from genetic errors, whereas secondary immunodeficiency diseases are acquired after birth and are due to agents such as infections, irradiation, or steroids

8 0
3 years ago
Other questions:
  • Name another genetic variation among humans that might be an adaptation to the environment
    11·1 answer
  • Heterozygous Cp cp chickens express a condition called creeper, in which the leg and wing bones are shorter than normal (cp cp).
    13·1 answer
  • What are the four most common occurimg chemical elements in organisms​
    5·1 answer
  • In a field study by Shultz and his colleagues (2007),several households in a neighborhood received weeklyfeedback about their le
    11·1 answer
  • Solar energy received by the Earth's surface causes the Earth's surface to heat up during the day. Which of the following heat t
    15·2 answers
  • What are invasive species?
    6·1 answer
  • g It was noted in the Experimental Pathways feature in Section 10.4 that at least two- thirds of the human genome is derived fro
    9·1 answer
  • (im failing yall sos) while working on a group project for school, a student asked his group member to check his model of a sect
    7·1 answer
  • Which of the following is NOT one of the key characteristics of a well-designed test?
    5·1 answer
  • Which of the following do NOT spawn or breed in freshwater and spends most of their lives in the ocean?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!