1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
torisob [31]
3 years ago
13

HELP PLEASE EXPLAIN YOUR ANSWER!!!

Biology
2 answers:
Gelneren [198K]3 years ago
6 0

1. The right answer is It helps keep the organelles in place and directs their movement as needed.

The cytoskeleton provides a certain rigidity to the cell and serves for the fixation of organelles (equivalents for the organ cell for an organism).

The cytoskeleton is constantly reorganized and thus governs the internal movements (displacement of chromosomes for example) and the deformations of its membrane (production of protuberances, invaginations, sites of adhesions ...).


2. The right answer is The cell's energy level will diminish as the enzyme decreases.

Cellular respiration is the set of biochemical reactions leading to the formation of ATP,  energy source of the cell.

This mechanism consumes oxygen and creates carbon dioxide as waste. That's why we talk about cellular respiration.

It is the three-step set, glycolysis, the Krebs cycle and the electron transport chain related to oxidative phosphorylation, which lead to the formation of ATP. If these reactions are not assured by lack of enzymes then there will be no production of ATP (energy production).


3. The right answer is Whales are able to conserve oxygen better than humans.

As the duration of the dive of some whale species can reach more than one hour, they use other means to breathe. In vertebrates, myoglobin, a protein, transports and stores oxygen in muscle tissue. It works like hemoglobin that carries oxygen in red blood cells. It is also myoglobin concentration very strong that makes their flesh bright red color, almost black. Thus, whales use the oxygen stored in the muscles to dive for long periods.

Ivahew [28]3 years ago
4 0
1. it acts as a framework inside the endoplasmic reticulum and keeps it from collapsing . It helps keep the organelles in place and directs their movement as needed . it keeps the DNA safely enclosed in the nucleus and holds the nucleus together . It provides anchoring places for the cell cytoplasm and help it move molecules.

2. <span>D) The cell's energy level will diminish as the enzyme decreases

3. W</span><span>hales have cells that produce energy differently than humans. </span>
You might be interested in
Why would an organism abruptly show up in the fossil record
Sophie [7]

C. An organism experienced punctuated equilibrium and rapidly evolved into another organism entirely.

6 0
4 years ago
Read 2 more answers
The use of non-local resources is associated with certain economic and environmental consequences.
Vikki [24]

Answer:

The answer is true

Explanation:

For example, buying from larger stores like walmart and costco without buying from local, smaller stores can put local stores out of business.

8 0
4 years ago
Read 2 more answers
The hard outer covering of a lobster is called the
Maurinko [17]
Its the exoskeleton lobsters are crustaceans also known as under water arachnids but they are originally called <span>arthropods.</span>
5 0
4 years ago
Read 2 more answers
I nee help brinlist i will give it to you
Montano1993 [528]

Answer:

A

Explanation:

The energy carried by electromagnetic waves is sometimes referred to as radiant energy. Electromagnetic waves do not require a medium for propagation hence they can travel through vacuum and are known to transmit enormous amount of energy.

Electromagnetic waves transmit energy away from the source of the wave. Hence the answer chosen in the answer section above.

3 0
3 years ago
What is the importance of the envelope to a virus? PLSSS HELPP!!!
True [87]

Answer:

The viral envelope serves several functions, including protecting the RNA or DNA molecule(s), evading recognition by the immune system, and facilitating virus entry. Despite these commonalities, viral envelopes come in a wide variety of shapes and configurations.

Explanation:

8 0
3 years ago
Other questions:
  • The distance north or south of the equator , as measured in degrees is called?
    10·1 answer
  • Which of the following is the best description of radiation? A. the process by which a liquid is converted to its vapor phase by
    7·1 answer
  • Which substance is a fuel used in nuclear power plant
    14·2 answers
  • Who would have been MOST likely to claim that a slight protrusion in a certain region of someone's skull would indicate that the
    13·1 answer
  • The p53 gene performs what function?
    11·2 answers
  • What are three examples of respiration?
    7·1 answer
  • What contains paired statements that can be used to identify organsims?
    11·1 answer
  • The_______system is the main transport system of the human body. it is made up of the heart,blood,and blood vessels namely______
    9·1 answer
  • Which characteristics describe cnidarians? Check all that apply.
    13·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!