1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astra-53 [7]
3 years ago
5

The blood type trait is controlled by more than two alleles for a given gene and therefore is called multiple alleles.

Biology
2 answers:
Charra [1.4K]3 years ago
5 0

Answer:

TRUE

Explanation:

lesya692 [45]3 years ago
3 0

Answer: it's true :0) hope I helped

You might be interested in
Which material do humans not rely on soil to help provide?
emmasim [6.3K]

Answer:

A. Aluminum for cans

Explanation:

Aluminum is a chemical element that is mined.

6 0
4 years ago
Read 2 more answers
Compare the change in thickness of the uterine lining with change in progestrone amount for days 10-27
Arte-miy333 [17]
-17 this is the answer becuase you subraction 
3 0
4 years ago
Please answer ASAP
stellarik [79]

Answer:

B

Explanation:

5 0
3 years ago
What class of flatworms is the largest parasitic group?
Vitek1552 [10]

Answer:

Class Monogenea

This is one of the largest groups of flatworms whose members as almost exclusively parasites of aquatic vertebrates (ectoparasites).

3 0
4 years ago
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0
2 years ago
Other questions:
  • The ends of roots are normally covered in tiny root hair cells. what is their function?
    8·2 answers
  • Which hormone is used in testing for pregnancy?
    11·1 answer
  • Which phrase describes a keystone species?
    13·2 answers
  • B. How would you characterize stars in this group?​
    11·1 answer
  • Earth is made up of four main spheres. The geosphere refers to the rocks, minerals, and natural landforms that make up Earths su
    6·2 answers
  • What happens in the small intestine?
    6·1 answer
  • What in-group biases do you see around you? Explain
    15·1 answer
  • M<br> +<br> +<br> Cl2 +<br> KI -&gt;<br> KC +<br> 12
    7·1 answer
  • An experiment is designed to compare the effects of glucose and sucrose on the osmoticpotential of a model cell. Two dialysis ba
    7·1 answer
  • Why does the cell sometimes have to expend energy to move individual molecules across the cell membrane?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!