1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marshall27 [118]
3 years ago
11

Which of the following is an observation about the bird pictured below

Biology
1 answer:
lianna [129]3 years ago
8 0
There is no picture of the bird.
You might be interested in
Why or how are calories "wasted" during gluconeogenesis?
ira [324]

luconeogenesis is a ubiquitous process, present in plants, animals, fungi, bacteria, and other microorganisms.[2] In vertebrates, gluconeogenesis takes place mainly in the liver and, to a lesser extent, in the cortex of the kidneys. In ruminants, this tends to be a continuous process.[3] In many other animals, the process occurs during periods of fasting, starvation, low-carbohydrate diets, or intense exercise. The process is highly endergonic until it is coupled to the hydrolysis of ATP or GTP, effectively making the process exergonic. For example, the pathway leading from pyruvate to glucose-6-phosphate requires 4 molecules of ATP and 2 molecules of GTP to proceed spontaneously. Gluconeogenesis is often associated with ketosis. Gluconeogenesis is also a target of therapy for type 2 diabetes, such as the antidiabetic drug, metformin, which inhibits glucose formation and stimulates glucose uptake by cells.[4] In ruminants, because dietary carbohydrates tend to be metabolized by rumen organisms, gluconeogenesis occurs regardless of fasting, low-carbohydrate diets, exercise, etc.[5]

3 0
3 years ago
Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing
AnnyKZ [126]

Answer:

Statements that are true are:

B) in splicing, intron sequences are removed from the mRNA in the form of lariats (loops), and are degraded = TRUE

C) one mRNA can sometimes code for more than one protein by splicing at alternative sites = TRUE

E) splicing occurs while the mRNA is still in the nucleus = TRUE

Statements that are false are:

A) splicing occurs while the mRNA is attached to the nucleosome = FALSE

D) splicing of mRNA does not involve any proteins = FALSE

4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Identify the labeled structures.
ANTONII [103]

Answer: A = nucleus, B = plastids , C = ribosomes   , D = cytoplasm

Hope it helps u! pls mark as brainliest!

5 0
3 years ago
What is the structure of a stem
erica [24]
Vascular tissue composed of xylem<span> (red) and </span>phloem<span> tissue (green, between the</span>xylem<span> and </span>cortex<span>) surrounds the pith. Collenchyma cells are elongated cells with unevenly-thickened walls . They provide structural support, mainly to the stem and leaves.</span>
3 0
3 years ago
Other questions:
  • which plane velocity was greatest? Yeagers Bell x-1, The Concorde, SR71 blackbird, none they all traveled at the same speed.
    5·1 answer
  • Five different species of warblers, seed-eating birds, live in the same species of conifer trees. All of the birds migrate to co
    9·1 answer
  • PLZ PLZ PLZ HELP ME I AM LITERALLY CRYING THIS IS SO STRESSFUL!!
    8·2 answers
  • List atleast 3 limiting factors that could impact the resources available for a population of lions.
    14·1 answer
  • Individuals without AFS have a glutamic acid at position 487 on the ALDH2 protein, whereas individuals with AFS have a lysine at
    5·1 answer
  • A roller coaster car is at the top of a 72 m hill and weighs 966 N. What is the coasters potential energy?
    10·1 answer
  • Which of the following statements is true regarding the "Egg Slap" demonstration on Tuesday and how it relates to Newton's First
    14·1 answer
  • Please help will mark brainliest answer.Which of the organisms in this food web obtains its energy from BOTH producers and consu
    11·1 answer
  • Describe the six main classes of algae
    8·1 answer
  • Which animal adapts in goa​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!