1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
8

El nombre de 10 animales y 10 plantas usando las normas de Carlos linneo

Biology
1 answer:
sattari [20]3 years ago
4 0
What's the questions here ?
You might be interested in
Why did Gregor Mendel remove the sex parts from two different groups of plants?
sashaice [31]

Answer:

Mendel was interested in the offspring of two different parent plants, so he had to prevent self-pollination. He removed the anthers from the flowers of some of the plants in his experiments. ... The offspring that result from such a cross are called hybrids.

Explanation:boom

5 0
3 years ago
Vhat is the function of the cell wall in a plant cell?
In-s [12.5K]

Answer:

The cell wall gives the plant stability

Explanation:

6 0
3 years ago
Read 2 more answers
What makes finches in the Galápagos Islands a good example of speciation?
Usimov [2.4K]
Well the finches there vary all over the islands there are many different ones who are similar but have a slight varitaion
4 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What are the two factors that define our traits?
coldgirl [10]

There are a few theories as to what defines our traits to create our personality

According to one such theory, Dan P. McAdams claims our personalities develop in <span>three </span>stages:

<span>Our genes cause genetic mutations forming a 'draft' personality.During our early upbringing, our parents, teachers and friends treat us differently based on our looks and draft personality.Once we are older we then form a narrative of our lives based on our experiences growing up, and make decisions consistent with the character we have created.</span>

So our traits started from slight genetic variances, which effected how we were treated, which then shapes our own self-narrative. So really, our personality is one big story that we tell ourselves, and our childhood was the prologue to that story.

6 0
3 years ago
Other questions:
  • Which component of the cardiovascular system allows the body to function by supplying the cells with oxygen?
    11·1 answer
  • The _________ is the main artery that receives blood from the left ventricle of the heart distributes it to the body.
    15·1 answer
  • What is the effect of ph and temperature on an enzyme
    11·1 answer
  • Neurons are highly specialized cells that have lost the ability to divide.what phase are neurons in?
    5·2 answers
  • Mako sharks weigh about 1000 pounds when they reach maturity. Suppose that in a gulf near South America, the following food chai
    11·2 answers
  • Which factor most directly affects the wind speed between two locations?
    8·1 answer
  • 6 At what temperature does liquid
    8·2 answers
  • Someone help with this pls
    9·1 answer
  • Plants get their energy from the sun through photosynthesis. This energy is trapped in bonds of complex compounds the plants cre
    14·1 answer
  • (20 points) {brainliest}
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!