1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
attashe74 [19]
3 years ago
15

In New York State, small farms that were

Biology
1 answer:
VikaD [51]3 years ago
7 0
When in New York State, small farms that were <span>abandoned many years ago have become hardwood forests, this would be an example of "</span><span>(3) ecological succession"</span>
You might be interested in
Can you guys please help me on this
Semenov [28]
They need to divide so they replace old or damaged cells
3 0
3 years ago
Sand and gravel are staples of the construction industry.
Igoryamba

Answer:

It is NOT D

Explanation:

On edge, the answer is NOT weathering

3 0
3 years ago
Please help me!! Worth 30 points
alekssr [168]

Answer: See below

Explanation:

Solar energy: Advantages: Solar energy is pollution free and causes no greenhouse gases to be emitted after installation. Disadvantages: Although solar energy can still be collected during cloudy and rainy days, the efficiency of the solar system drops.

Wind energy: Advantages: It doesn't pollute air like power plant relying on combustion of fossil fuel. Disadvantages: Wind turbines can be a threat to wildlife (e.g. birds, bats).

Hydroelectric energy: Advantages: Hydroelectric energy is fueled by water, so it's a clean fuel source, meaning it won't pollute the air like power plants that burn fossil fuels, such as coal or natural gas. Disadvantages: Electricity generation and energy prices are directly related to how much water is available. A drought could potentially affect this.

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
MATCH THE FOLLOWING
Kaylis [27]

Answer:

1) Homologous chromosomes are chromosomes that are the same in size and shape and control the same characteristics; occur in pairs in higher animals and plants

2) Internal fertilization is a mating pattern in which the male and female come close together, the male introduces the sperm into the body of the female, and fertilization occurs. It is practiced by mammals like goat, sheep etc

3) Pollination is the transfer of pollen from male to female cones in gymnosperms, or from anther to stigma in flowering plants. It is effected by insects, birds, bats and the wind.

4) Zygote is the result of fertilization in which two gametes have fused together; often simply called a fertilized egg.

7 0
3 years ago
Other questions:
  • What is the medical term for the ventral fold of tissue that attaches the foreskin to the glans?
    8·1 answer
  • Where should a doctor look to see if the large intestine is working properly?
    6·2 answers
  • Why might farmers use artificial selection to develop different types of vegetables?
    15·1 answer
  • Explain how asexual and sexual reproduction are different with emphasis or genetic diversity
    10·1 answer
  • How many electrons does barium have to give up when forming an ion
    10·1 answer
  • Circle the letter of each sentence that is true about the cell wall.
    12·2 answers
  • 3. Which of the following is a major functional characteristic of all organisms? (a) movement,
    7·1 answer
  • PLEASE HELP ME!!!!<br> IT IS FOR BIOLOGY!!!
    14·2 answers
  • Where do the fruits and seed of the mango come from?​
    15·1 answer
  • Active transport is different from simple diffusion because active transport
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!