They need to divide so they replace old or damaged cells
Answer:
It is NOT D
Explanation:
On edge, the answer is NOT weathering
Answer: See below
Explanation:
Solar energy: Advantages: Solar energy is pollution free and causes no greenhouse gases to be emitted after installation. Disadvantages: Although solar energy can still be collected during cloudy and rainy days, the efficiency of the solar system drops.
Wind energy: Advantages: It doesn't pollute air like power plant relying on combustion of fossil fuel. Disadvantages: Wind turbines can be a threat to wildlife (e.g. birds, bats).
Hydroelectric energy: Advantages: Hydroelectric energy is fueled by water, so it's a clean fuel source, meaning it won't pollute the air like power plants that burn fossil fuels, such as coal or natural gas. Disadvantages: Electricity generation and energy prices are directly related to how much water is available. A drought could potentially affect this.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
1) Homologous chromosomes are chromosomes that are the same in size and shape and control the same characteristics; occur in pairs in higher animals and plants
2) Internal fertilization is a mating pattern in which the male and female come close together, the male introduces the sperm into the body of the female, and fertilization occurs. It is practiced by mammals like goat, sheep etc
3) Pollination is the transfer of pollen from male to female cones in gymnosperms, or from anther to stigma in flowering plants. It is effected by insects, birds, bats and the wind.
4) Zygote is the result of fertilization in which two gametes have fused together; often simply called a fertilized egg.