1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
2 years ago
11

What are the disadvantages of transmission electron microscope?

Biology
1 answer:
Arada [10]2 years ago
6 0

A Transmission Electron Microscope is an impressive instrument with a number of advantages such as:

TEMs offer the most powerful magnification, potentially over one million times or more

TEMs have a wide-range of applications and can be utilized in a variety of different scientific, educational and industrial fields

TEMs provide information on element and compound structure

Images are high-quality and detailed

TEMs are able to yield information of surface features, shape, size and structure

They are easy to operate with proper training

Disafvantages:

Some cons of electron microscopes include:

TEMs are large and very expensive

Laborious sample preparation

Potential artifacts from sample preparation

Operation and analysis requires special training

Samples are limited to those that are electron transparent, able to tolerate the vacuum chamber and small enough to fit in the chamber

TEMs require special housing and maintenance

Images are black and white


You might be interested in
Which of the following accurately describes the binomial nomenclature naming system?
defon
Yes it's A definitely correct
7 0
2 years ago
Read 2 more answers
Science is best described as a
Alinara [238K]
The answer is d which is set of facts because science is facts
3 0
3 years ago
What are the parts of the animal cell and what do they do<br> please help im in urgent need for real
nignag [31]
The components<span> of </span>animal cells are centrioles, cilia and flagella, endoplasmic reticulum, golgi apparatus, lysosomes, microfilaments, microtubules, mitochondria, nucleus, peroxisomes, plasma membrane and ribosomes.<span>The centrosomes is where microtubules are made. During </span>cell<span> division (mitosis), the centrosome divides and the two </span>parts<span> move to opposite sides of the dividing </span>cell<span>. The centriole is the dense center of the centrosome. cytoplasm - the jellylike material outside the </span>cell<span> nucleus in which the organelles are located. Thats what i found when i researched about animal cells. Hope this helps, I put what i know and reaserched the rest.</span>
3 0
2 years ago
Which is not true of an introduced species?
cupoosta [38]
I believe the answer is A
8 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Other questions:
  • A group of students went on a forest trail as part of their project activity. They were given a task of calculating the NPP of a
    13·1 answer
  • Identify the two body systems that identify when your body temperature lowers and then shivers to keep you warm.
    12·2 answers
  • This reproduce structure can be considered an advancement over spores it protects the embryo from injury and drying out it also
    9·2 answers
  • Where does water come from ?
    14·2 answers
  • Which of the following is NOT a function of proteins?
    14·1 answer
  • Dipeptidases and disaccharidases are produced in the ____ and act in the _________.
    5·1 answer
  • Why do you think the human stomach pH range is 2.0 - 3.0?
    9·1 answer
  • Which contains mostly hydrocarbons?<br><br> carbohydrates<br> proteins<br> salt<br> gasoline
    9·2 answers
  • What is recycling? How does it help in management of hazardous waste?​
    10·2 answers
  • I need help filling in the blink
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!