1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lesechka [4]
3 years ago
10

Pls helps on any of them that you could

Biology
1 answer:
frutty [35]3 years ago
5 0

Answer:

I answered 5 and 6

Explanation:

Prophase is where the nuclear envelope breaks down and chromosomes condense and become visible. Metaphase is where the chromosomes align in the middle of the cell, which in prophase, the newly visible chromosomes are scattered amongst the cells.

Interphase is the resting state of the cell, where a cell spends most of it's life in. But while it's active, cellular organelles double in number, the DNA replicates, and protein synthesis occurs.

You might be interested in
Scientists say the planet Venus has a "runaway greenhouse effect." What condition would you expect on Venus as the result of a r
kenny6666 [7]
I say A not for sure though!
7 0
3 years ago
Read 2 more answers
8. Which pattern of inheritance is responsible for a wide range of phenotypes that result from individual organisms having many
Romashka [77]
The answer is D Multiple alleles 
3 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which 2 organs perform both chemical and mechanical digestion?
r-ruslan [8.4K]

Answer:

Mouth and stomach.

Explanation:

4 0
3 years ago
What is #34 answer ??
Illusion [34]
B.the mass of carbon dioxide plus water is less than that of paper plus oxygen.
8 0
3 years ago
Other questions:
  • Hey guys. So I need your help I have this rock presentation assignment worth 90 points and I have to find a good title. It’s abo
    8·1 answer
  • American vultures used to be classified in the same family as African vultures. Which discovery caused scientists to reclassify
    5·1 answer
  • What was the original purpose of this research study
    13·1 answer
  • The national government wants to increase the number of national parks and recreation areas. How will this act help with the sus
    11·2 answers
  • I need help asap.
    13·1 answer
  • PLEASE HELP!
    7·1 answer
  • Plzz help this is confusing
    7·1 answer
  • ????..................
    13·1 answer
  • True or false: concept that cells or organisms maintain specific internal conditions
    6·2 answers
  • Where in the body are the special cells that detect the change in colour of the<br> traffic lights?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!