1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lesechka [4]
2 years ago
10

Pls helps on any of them that you could

Biology
1 answer:
frutty [35]2 years ago
5 0

Answer:

I answered 5 and 6

Explanation:

Prophase is where the nuclear envelope breaks down and chromosomes condense and become visible. Metaphase is where the chromosomes align in the middle of the cell, which in prophase, the newly visible chromosomes are scattered amongst the cells.

Interphase is the resting state of the cell, where a cell spends most of it's life in. But while it's active, cellular organelles double in number, the DNA replicates, and protein synthesis occurs.

You might be interested in
Inheritance patterns cannot always be explained by Mendel's models of inheritance. If a pair of homologous chromosomes fails to
soldier1979 [14.2K]

The question is incomplete as it does not have the options which are:

A) n+1; n+1; n-1; n-1

B) n+1; n-1; n; n

C) n+1; n-1; n-1; n-1

D) n+1; n+1; n; n

Answer:

Option-1

Explanation:

The laws of inheritance were concluded from the result of Mendel's experiment which is based on the fact that gametes are formed. Later research suggested that gametes are formed by the process of meiosis which takes place in two phases and recombination is a characteristic of Meiosis.

If during anaphase I of meiosis I, the alleles fails to separate that is nondisjunction takes place at anaphase I, Then the resulting daughter cells will have unequal distribution of chromosomes.

One daughter cell will receive 1 extra copy of the chromosome while another daughter cell will receive 1 less chromosome therefore ploidy level will be n+1 and n-1.

During meiosis II, 2 more daughter cells will be formed with the same ploidy level therefore in last the meiosis will result in 2 (n+1) and 2 (n-1) cell.

Thus, Option-1 is the correct answer.

4 0
3 years ago
What is true of saturated fatty acids?
anzhelika [568]

<u>Answer:</u>  They have the maximum number of hydrogen atoms.

<em>Saturated fatty acids have the maximum number of hydrogen atoms.</em>

<u>Explanation:</u>

A fatty acid that doesn’t contain any double bond between carbons in their molecular structure is known as saturated fatty acid. They are also incapable of absorbing hydrogen in their molecular structure thus the name.

Saturated fatty acids are generally found in animal fats like butter, milk and dairy products. Because of the higher melting point of those fatty acids, they are generally found in solid state at reem temperature.

6 0
3 years ago
by the time jefferson was reelected for a second term foreign relations with france and britain were A. Strong B. Resolved C. St
ivolga24 [154]

Answer: C. Strained

Explanation:

The diplomatic neutrality of the United States was tested during the Napoleonic Wars . The warring nations of Britain and France both imposed trade restrictions in order to weaken each other's economies. These restrictions also disrupted American trade and threatened American neutrality.

8 0
2 years ago
The hormone produced by the pancreas which controls the amount of glucose in the blood is called:
ozzi
Insulin is the answer
3 0
2 years ago
Refrigerating perishable foods affects biochemical reactions by A) increasing concentrations of antioxidants. B) removing bacter
LuckyWell [14K]
C is the correct answer
8 0
3 years ago
Other questions:
  • If an individual has 7 gene pairs, how many different gametes can be formed if two of the gene pairs are homozygous and the rema
    9·1 answer
  • You have before you a living organism, which you examine carefully. Which of the following should convince you that the organism
    8·1 answer
  • What process takes small molecules and puts them together to form macromolecules
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • 8. if you removed all the cheetahs from a large area of savanna which of the following is a direct effect that could be explaine
    6·2 answers
  • Blood carries oxygen from the lungs and distributes it to all the cells in the body. Which blood cells are responsible for this
    11·1 answer
  • ALOT OF POINTS MARKING POEPLE AS BRAINLIST
    14·2 answers
  • What process do animals go through in molecular energy is available?
    10·1 answer
  • ................................
    6·2 answers
  • What is an advantage of using coal, oil, and natural gas (fossil fuels)?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!