1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alekssandra [29.7K]
3 years ago
8

%5C%3BPoints%21%5C%3BNO%5C%3Banswers%5C%3Bbreaking%5C%3BBrainly%5C%3Bguidelines%5C%3Bplease%21" id="TexFormula1" title="Write\;a\;story\;about\;your\;best\;fishing\;trip!\\\\50\;Points!\;NO\;answers\;breaking\;Brainly\;guidelines\;please!" alt="Write\;a\;story\;about\;your\;best\;fishing\;trip!\\\\50\;Points!\;NO\;answers\;breaking\;Brainly\;guidelines\;please!" align="absmiddle" class="latex-formula">
Biology
1 answer:
bearhunter [10]3 years ago
5 0

Answer:

When I first read this question, all I could think about was the capsized fishing charter called, “the Erik”. The inept captain and crew of this boat caused the death of four passengers while three others remain missing. This disaster occurred back in 2011. I knew two of the passengers. One was recovered in 2013. The other is still listed as missing. However, this question concerns the “best story”. So, I’ll give you the accounts of my own experience. Back in 2013, my group of long-range fishing friends had chartered our annual 8-day trip out of Point Loma, San Diego. We had always chartered the same boat; the Shogun. At our traditional dinner the night before boarding, I remember the most notable topic being discussed was the remnants of Hurricane Ingrid. Ingrid had caused high winds and seas in the area where we wanted to fish.

You might be interested in
A- What is the ratio of the genotypes in the punnet square you created?
Vanyuwa [196]

Answer:

A genotype is an individual's collection of genes. The term also can refer to the two alleles inherited for a particular gene. The genotype is expressed when the information encoded in the genes' DNA is used to make protein and RNA molecules.

8 0
3 years ago
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
2 years ago
Which term belongs<br> in the blank in the<br> cartoon?<br><br> A. RNA<br> B. Protein<br> C. DNA
Andrej [43]
C. DNA I believe because DNA turns into RNA and then turns into mRNA to amino acids
6 0
1 year ago
Help cuh im to lazy and o don fill like doin this ill give u 25 points
aniked [119]
It’s easy bro just do it
8 0
3 years ago
Read 2 more answers
What is an example of selective breeding
Rudiy27
An example of selective breeding is breeding cattle to produce better meat.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which describes an interaction within the musculoskeletal system?
    11·2 answers
  • Research has shown that eating too much carbohydrate can cause diabetes.​ <br> a. True <br> b. False
    14·1 answer
  • Which stage of the cell cycle involves the division of the cell’s nucleus? mitosis cytokinesis interphase replication
    14·2 answers
  • Most freshwater Hydrozoa exist only as ______.
    12·1 answer
  • T object]user: do dogs smile?
    14·1 answer
  • What is a constant.here what it is
    12·1 answer
  • an organism was hunted almost to Extinction but the population bounced back which evaluationary changed did the species most lik
    9·2 answers
  • What are the factors of 74
    8·1 answer
  • A shoreline's first line of defense against hurricanes is​
    14·1 answer
  • Why are microorganisms used to produce enzymes?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!