1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
2 years ago
13

Cross a red flower (AaBB) with a pink flower (AaBb). What are the expected phenotypic ratios of offspring?

Biology
1 answer:
defon2 years ago
6 0

Answer:

Cross a red flower (AaBB) with a pink flower (AaBb). What are the expected phenotypic ratios of offspring?

AaBB x AaBb= AABB, AaBb, AaBB, aaBb

Phenotyic ratio is 3:1

Explanation:

You might be interested in
At this boundary, crust is neither created nor destroyed.
salantis [7]

Transform boundary – this type of fault is found where two tectonic plates are moving alongside and parallel to each other mostly in opposite directions. This type of fault is also responsible for the rift valley and block mountains. No crust is destroyed nor new crust formed.

Convergent boundary – At this point, two tectonic plates are colliding because they are moving in opposite directions at each other. The pressure and stress of the collision force causes the plates to begin crumpling and folding at the boundary forming features such as fold mountains (an example is the Himalayas).

Convergent boundary – At this boundary , the denser of the two colliding tectonic plates (usually the oceanic plate) is subsided by the less dense one (usually the continental plate). The plate being subsided begins to melt as it does down into the mantle and becomes liquid rock. This magma rises through the fissures formed at the boundary and erupts into volcanic islands along the boundary.

4 0
2 years ago
What is biotechnology? causing random mutations in bacterial plasmids changing an organism’s genes to make new molecules infecti
Anna [14]
Biotechnology is changing an organism’s genes to make new molecules, B.
3 0
3 years ago
Read 2 more answers
Which chicken wing is this? Right or left wing explain ur answer 50 POINTS ON THE LINE FOR RIGHT ANSWER
amid [387]

Answer:

tfcvtucfgc,tuyftcvkty

Explanation:

hcv gfklv,gh fhk,

6 0
3 years ago
In the United States there are strict fishing seasons and limits, but not all countries enforce similar laws. In Bangladesh ther
givi [52]

Answer: Small countries, such as Bangladesh, are practicing subsistence fishing, taking only the fish needed to survive.

Explanation:

7 0
3 years ago
Energy is released from ATP when
Mariana [72]

Answer:

D. A phosphate group is removed.​

Explanation:

When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate

Hope this helps you and anyone else who needs it!!! :)

8 0
3 years ago
Other questions:
  • I found a baby snow leopard behind my house and adopted it.
    14·2 answers
  • What is the main functions of lipids?
    11·2 answers
  • Jane took two identical boxes, one made of black-colored paper and the other made of white-colored paper. She placed one ice cub
    14·2 answers
  • Some viruses can be crystallized and their structures analyzed. One such virus is yellow mottle virus, which infects beans. This
    13·1 answer
  • What is one specific, realistic and feasible way we can help protect the world’s fisheries from being completely depleted.
    11·1 answer
  • A point mutation changes the DNA sequence CGA to CGT, but the same protein is still produced. Which point mutation occurred? A.
    8·2 answers
  • if a parent cell has 10 chromosomes, how many chromosomes will be in each daughter cell after mitosis
    11·2 answers
  • What technique did Hershey and Chase use in their experiment that led to the conclusion that DNA, not protein, was the genetic m
    5·1 answer
  • A food chain what, put it in order..
    12·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!