What organelles contain DNA?

Biology

2 answers:

Andru [333]3 years ago

7 0

The nucleus and rna

svp [43]3 years ago

3 0

Answer:

nucleus contains the DNA

Explanation:

The nucleus is a membrane-bound organelle that contains genetic material (DNA) of eukaryotic organisms. As such, it serves to maintain the integrity of the cell by facilitating transcription and replication processes. It's the largest organelle inside the cell taking up about a tenth of the entire cell volume.

DNA (Deoxyribonucleic acid) is a molecule composed of two chains that coil around each other to form a double helix carrying genetic instructions for the development, functioning, growth and reproduction of all known organisms and many viruses

You might be interested in

Explain the processes of transcription and translation

allochka39001 [22]

The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to produce proteins is called translation.

4 0

2 years ago

Read 2 more answers

What assumptions did Engelmann make in order to conclude that red and violet-blue light were more effective than green light in

iren [92.7K]

Answer:

The distribution of chloroplasts in each algae cell was approximately the same.

The number of bacteria grouped at each wavelength (color) was approximately proportional to the amount of oxygen produced by this part of the algae.

Explanation:

Photosynthetic pigments absorb blue, red and green lights. The wavelength of light that is the most effective in driving photosynthesis is 420 nanometers, which corresponds to blue light.

The wavelength of 475nm and 650nm are most effective in driving photosynthesis.

6 0

2 years ago

Match these up

artcher [175]

5. to B. 3. to E. 2 to A. 1. to D. 4. i believe is C.

6 0

2 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0