If you plant your potatoes in late August, while it is still hot, you may still have them in the cooler months after. Cool weather doesn't really harm potatoes, they can still grow then, it is only when it is frosty that potatoes die off. The foliage will die, but the potatoes will remain securely underground until you are ready to dig them out. Additionally, potatoes can be grown indoors so that you can always have them.
Answer:
Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).
If you're referring to rainfall, much of the water evaporates eventually after reaching Earth's surface. If it falls in the ocean of course that is not usually the case.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
