1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pachacha [2.7K]
3 years ago
7

True or false: one enzyme can catalyze only one specific type of reaction.

Biology
2 answers:
Troyanec [42]3 years ago
3 0
Yes statement is true.
Maurinko [17]3 years ago
3 0

the correct answer is true

You might be interested in
What would happen to the environment if all the nitrogen fixing bacteria died??
Evgesh-ka [11]
trees do not fix N2 from air they fix oxygen with the help of N2 fixing bacteria . so trees do not fix N2
3 0
3 years ago
How did the bacteria S. aureus change over time?
ella [17]

Answer:

It adapted and became resistant to penicillin

3 0
3 years ago
Cloud A has absorbed heat and cloud B has released heat. Which cloud will release rain and why?
lidiya [134]

CLoud b would release rain because it is the first one to release heat.

3 0
3 years ago
Name one safety hazard in the ph lab hazards simulation
MaRussiya [10]

Answer:

Typically, strong acids and bases, solutions with a pH < 2 or a pH > 12, and some solvents, such as formic acid, glacial acetic acid, and trifluoroacetic acid, which are particularly aggressive against tissue.

Explanation:

8 0
3 years ago
Multiple choice just double checking the answer would be D Correct?
Paladinen [302]

Explanation:

John Dalton proposed the theory of matter which is popularly known as the Dalton's atomic theory. In the atomic theory, Dalton identified from his experiments on gases that every matter is made up of small indivisible particles called atoms. These atoms are the smallest fractions of a matter.

  • All the atoms of an element are all alike.
  • Compounds form from atoms by simple whole number combinations alone.
  • Chemical combination of atoms involves the rearrangement of reactants.

Therefore, using these clues you should be able to answer the question.

Learn more:

Dalton atomic theory brainly.com/question/1979129

#learnwithBrainly

7 0
3 years ago
Other questions:
  • Lillette, 9, has been diagnosed with _____, a cancer in which the bone marrow manufactures an abundance of abnormal white blood
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Key parts of the three major neurons
    15·1 answer
  • in an experiment on the traffic 20 cars are observed driving down the street in 4 hours what rate of traffic was observed in thi
    9·2 answers
  • The striations in skeletal muscle fibers are attributable to
    10·1 answer
  • When you look at the Sun through a filtered telescope, the visible portion of the Sun appears blotchy. These blotches are called
    8·2 answers
  • Is there anything farther than space itself?
    15·2 answers
  • Gold is ...
    13·2 answers
  • 7.
    7·1 answer
  • Which of these is NOT a reason for mitosis in humans?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!