1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ladessa [460]
3 years ago
14

Give two reasons why cells divide. Please help.

Biology
2 answers:
vredina [299]3 years ago
6 0
1. reproduction, because "new" cells must replace dead and damage cells, for example blood
2. for growth- tissue repair
3. creation of eggs or sperm

Greetings, 
n00nst00p :)
Dmitrij [34]3 years ago
5 0
For growth, repair and differentiation
You might be interested in
LIST AT LEAST THREE EXAMPLES OF HOW MICROBIAL PHOTOTROPHS ARE IMPORTANT CLINICALLY AND ENVIRONMENTALLY
zaharov [31]
Cyanobacteria are primitive organisms where chloroplasts are believed to be originated. These phototrophic organisms benefit the environmental and the clinical aspects because of their unique physiology. For instance, they contribute to energy attainment from sunlight which helps other organisms gain energy when this is consumed. Another is the contribution to biogeochemical cycles. And lastly, how these can aid in many medical discoveries and treatments.
3 0
3 years ago
Read 2 more answers
Explain where the pericardium is found and what it does for the heart?
Julli [10]

Answer:

The pericardium is the most outer layer of the heart. Main function to protect the heart from external forces/entry.

5 0
3 years ago
A teenager throws a 7.26 kg rock into a lake, trying to make a big splash. If the rock is travelling at a speed of 7.5 m/s, how
kherson [118]

Explanation:

K.E = 1/2mv²

1/2 x 7.26 x 7.5²= 204.19j

5 0
3 years ago
Marissa suffers from panic disorder, where she experiences unpredictable, unbearable episodes of panic that closely resemble the
Vsevolod [243]

Answer:

A. distress is the correct answer.

Explanation:

Marissa suffers from panic disorder, where she experiences unpredictable, unbearable episodes of panic that closely resemble the symptoms of a heart attack.(This description of her disorder represent distress)

Panic disorder is a stress disorder described by reoccurring sudden panic attacks.

Distress is a situation of severe stress or tension, usually caused by different factors such as failure in the exam, teasing, personal problems, loss of a job, etc.

Distress due to panic or anxiety affects a person's chance of undergoing cardiovascular problems such as stroke, heart attack, and health problems.

Distress changes in the process of blood clots and increases the blood pressure level, weaken the heart muscle that increases the problem of heart attack.

7 0
3 years ago
Bmi provides common language for doctors, dietitians and agencies like insurance companies to use as a method to determine an in
Ganezh [65]
BMI<span> (body mass index), which is based on the height and weight of a person, is an </span>inaccurate<span> measure of body fat content and does </span>not take into account muscle mass, bone density, overall body composition, and racial and sex differences.  <span>BMI is a substitute measure of body fatness because it is a measure of excess </span>weight<span> rather than excess body </span>fat<span>. Factors such as age, sex, ethnicity, and muscle mass can influence the relationship between BMI and body </span>fat<span>.</span>
6 0
3 years ago
Other questions:
  • Denaturation of dna is a necessary step in southern blotting procedure because it separates double stranded dna into single stra
    6·1 answer
  • Which part in cellular division is different in plant and animal cells
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The paired, rod-shaped ____ cartilages are located in the mucous membrane fold that connects the epiglottis to the arytenoid car
    14·1 answer
  • 36. In the Calvin cycle, where plants use the energy from photosynthesis to synthesize glucose, what enzyme is need for carbon f
    5·1 answer
  • Which element is NOT generally found in proteins ? A. carbon B. oxygen C. phosphorus
    5·1 answer
  • The bolus is liquefied in the ______ and it is now called chyme.
    15·1 answer
  • What does the skeletal part of the musculoskeletal system do? Why is 'protects the organs of the body' correct?
    6·2 answers
  • What are the end products of the HYDROLYSIS of a polysaccharide?
    11·2 answers
  • Pls help pls asap
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!