How would scientists know that there is life existing outside of Earth? What do they use?

1 answer:

3 0

They would know if they see anything like traces of water or anything else that would be nessecary for a living organism to have. They look for these with technology like the hubble telescope as well as the drone on Mars to gather as much information as possible.

You might be interested in

Why only female mosquito is responsible for the transfer of disease?

Sphinxa [80]

Explanation:

Issun Sengeki... Messatsu!

Alike of what the other guy said, only the female mosquito sucks blood.

Being that this is true, the mosquito(s) could have been in any environment. They could carry diseases and illnesses. On top of that, they can carry microscopic organism, unlike diseases, that can cause infections.

5 0

3 years ago

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

During the subjective data collection for pain assessment, the nurse asks the patient, "can you tell me what your discomfort fee

MariettaO [177]

The reason that this question is being questioned by the nurse to the patient is because of the reason that the nurse wants to know the quality of pain that the patient is exhibiting in which the nurse would likely ask the patient of how much pain she or he exhibits from the scale 0-10.

3 0

3 years ago

Which of these factors would most likely strengthen the effectiveness of

KIM [24]

B political interests

8 0

3 years ago

Read 2 more answers

Which of the following is a population?

kow [346]

Answer:

maybe C because it says different kind of fish that live in one area that is a lake