1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
horsena [70]
3 years ago
7

How is a primary succession different from secondary succession?​

Biology
1 answer:
lorasvet [3.4K]3 years ago
8 0

Answer:

Primary succession is the change in a community over a long period of time when secondary succession is the change in a community over a short period of time.

Explanation:

primary succession clues- occurs in completely destroyed places like a glacier that has melted, has pioneer species, and has a climax community

secondary succession clues- occurs in abonded places like an abandoned park, does not require pioneer species

You might be interested in
What must occur within a gene pool before the formation of a new species?
VLD [36.1K]
Reproductive isolation must happen

6 0
4 years ago
Read 2 more answers
What happened when the Colorado Plateau rose???
gayaneshka [121]
It started to mold what is now the grand canyons.
4 0
4 years ago
Why don’t we see evolution occurring in individual organisms?
IgorC [24]

Answer:

Because it usually takes a long time, and is a very long process.

Explanation:

4 0
3 years ago
All of the following statements about ferns are correct except:_________
Rasek [7]

Answer: B) because in higher plants, such as angiosperms and gymnosperms, the sporophyte is the dominant generation.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Drag the tiles to the correct boxes to complete the pairs. Match each type of muscle tissue to the action it performs in the bod
    9·1 answer
  • Describe how having dark skin may have provided an advantage in survival and reproduction to people thousands of years ago in so
    7·1 answer
  • Which of these is a physical property?
    12·2 answers
  • One of the Only <br> important reasons for using only reliable water sources is to reduce
    6·1 answer
  • What is the difference between Recessive and Dominant traits?
    12·1 answer
  • Hi I need help ???!!!
    13·2 answers
  • Planets with atmospheric ________ are warmer than those without.
    8·1 answer
  • How does the mutation present in 10% of Europeans protect their cells from HIV?
    7·2 answers
  • Axons insulated by a(n) _____ are able to conduct impulses faster that those not so insulated.
    11·1 answer
  • WHat are the answers 1-10 on brainpop lymphatic system pls help
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!