1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Burka [1]
3 years ago
12

Why does the appearance of the moon change each month?

Biology
2 answers:
blsea [12.9K]3 years ago
4 0

Answer:

its orbit

Explanation:

Marizza181 [45]3 years ago
3 0
The rotation of the earth around the sun
You might be interested in
Explain how goal of today’s classification system differs from earlier systems
gladu [14]

Classification systems previously were having very different goals than modern classification systems. If we look at old eras, scientists like Aristotle  and Theophrastus  tried to classify organisms on the basis of apparent characteristics, habitat and simple other traits.

Old classification systems had alot of errors and flaws. For example they classified fish and whale in one group because they lived in water, now we know fish is amphibian while whale is mammal.

So we can say that the goal o earlier classification system were just to make groups of organisms on the basis of External features.

Goal of modern classification system:

Modern classification approach was started by Linnaeus. It focuses more on biological delimitation and evolutionary histories than mere external characteristics. It organizes organisms in groups in such a way that grouping reflects their evolutionary relatedness. It is not just specie level but also focuses on sub-specie and population level classification.


Thus modern goal is better in many terms and is more reliable than old classification goals.


Hope it helps!

3 0
3 years ago
Which of the following statements is FALSE?
Naya [18.7K]

Answer: d. None of the above is false.

Explanation: The reasons are:

Intermolecular forces should be reduced when molecules need to be vaporized, otherwise they will not be converted into vapours.

When the temperature increases, forces of attraction decreases which allows molecules to evaporate because energy will be increased which allows molecule to break bonding between them. Hence increasing temperature has effect on vaporization.

Dispersion forces is the weakest force between molecules and hydrogen bond is strong so molecule having only dispersion force will evaporate at the higher rate.

8 0
3 years ago
Cell organelles can be seen with a light microscope true or false
Rama09 [41]

yes, cell organelles can be seen with a microscope

8 0
3 years ago
Read 2 more answers
Vestigial structures, such as hip bones in whalesand appendixes in humans, are those that havelittle or no function for the orga
yaroslaw [1]

Answer:

This structure has not been highly beneficial for the organism

Explanation:

Vestigial structures are cells, tissues, and/or organs that have no apparent function. Vestigial structures are retained during the course of the evolution, but often they are degenerate and/or atrophied (due to disuse). In general, these structures are homologous to anatomical structures that play a specific role in evolutionarily related species. Some examples of vestigial structures include, among others, the presence of the appendix in humans and wings in flightless birds.

6 0
3 years ago
What are the functions of proteins in living organisms?
Nastasia [14]

Answer: Protiens help provide structural support for our metabolism, and they can act as enzymes, carriers, or hormones to help us. They provide growth and maintenence and also act as messengers for our brain. They bolster our immune system and also transport/store nutrients. Basically, they do a whole lot!

Explanation:

4 0
3 years ago
Other questions:
  • Which process is responsible for continually wearing away the Earth's surface? deposition folding erosion faulting
    14·1 answer
  • Wasting away, or deterioration, of muscle is called ________.
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The energy required to run the Calvin cycle reactions of photosynthesis comes from which two substances produced during the ligh
    11·1 answer
  • What is the stomach pH of a hyena, shark, and a vulture?
    15·1 answer
  • What is the primary function of carbohydrates attached to the exterior of cell membranes?
    15·1 answer
  • I NEED HELP PLEASE!!!
    12·2 answers
  • Someone please help<br> it’s not the one highlighted and i need to get this rigjt
    10·1 answer
  • A population of wolves is reintroduced into Yellowstone National Park. For the first decade, the wolf population grows exponenti
    12·1 answer
  • Which part of the cell theory refers to the flow of energy through a cell?to the flow of information through a cell?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!