1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kitty [74]
3 years ago
11

All four types of amino acids

Biology
1 answer:
Ilia_Sergeevich [38]3 years ago
6 0

Answer:

Explanation:

There are basically four different classes of amino acids determined by different side chains: 1. non-polar and neutral, 2. polar and neutral, 3. acidic and polar, 4. basic and polar.

sorry if this doesn't help

You might be interested in
Metabolic pathways _____.
Mila [183]

The answer is B , i hope this helps

5 0
3 years ago
What are two purposes of the cell cycle
fgiga [73]

Answer:

The most basic function of the cell cycle is to duplicate accurately the vast amount of DNA in the chromosomes and then segregate the copies precisely into two genetically identical daughter cells.

Explanation:

7 0
3 years ago
Read 2 more answers
8) What is the manipulated variable in this experiment?
Murrr4er [49]

Answer:

As the variables are not given, let us help with general explanation on manipulated variable.

Explanation:

A manipulated variable is an independent variable. In a scientific experiment, an independent variable can be described as a variable which can change naturally or which is changed by the researcher to check its effect on the dependent variable. The dependent variable is the variable which is under study and being tested.

For example, to check the difference in photosynthesis rate by light, the amount of light will be the independent variable and the rate of photosynthesis will be the dependent variable.

8 0
3 years ago
Which of the following would have the greatest effect on natural selection within a geographically isolated population of elepha
Zanzabum
D Would Be The Best Choice :)
3 0
4 years ago
Read 2 more answers
Mr. White gives you an empty box and asks you to push it with 10N of force. He then puts all of the class textbooks in the box,
jarptica [38.1K]
The mass of the box increased and the acceleration of the box decreased
3 0
3 years ago
Other questions:
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • If you kick a soccer ball on the field of grass it will stop because
    10·1 answer
  • Name the phenomenon that results when a red flower plant is crossed with a white flowered plant and the offspring have pink flow
    7·1 answer
  • What plant physical structure or organ has a similar function to fish scales? Stem Stamen Bark Flower
    13·1 answer
  • Which of these is a long-term human health issue likely caused by air
    12·1 answer
  • How has the environment of this location changed since Basilosaurus lived?
    11·1 answer
  • Write down a mechanism for increasing genetic variation in BOTH eukaryotes and prokaryotes.
    10·1 answer
  • How did ants and butterflies get advantage of each other?
    9·2 answers
  • A population of 500 rabbits lives in an area that is 25 square miles. What is
    9·1 answer
  • 7 Infer Before scientists were able an to view and study the ocean floor directly , why might they have expected the ocean floor
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!