1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LiRa [457]
3 years ago
13

Roberto has just moved to a new address. When he is filling out an information page on a website he automatically starts to type

in his old address and then has trouble remembering his new address. What memory process explains why Roberto forgot his new address? Group of answer choices absentmindedness memory bias retroactive interference proactive interference
Health
1 answer:
Free_Kalibri [48]3 years ago
5 0

Answer:

Thus, the correct answer is - Proactive interference.

Explanation:

Proactive interference is a type of interference effect that involve the previous memories to hold back to form new memories and retain them. This include various prior retained memories such as old mobile numbers, address, and other material.

In this question Roberto is experiencing the same proactive interference by having difficulties to retain new address and still remember the old one.

Thus, the correct answer is - proactive interference.

You might be interested in
Everyone should exercise with the same frequency. Please select the best answer from the choices provided. T F
mestny [16]

Answer:

false

Explanation:

body is different and needs to be catered to

8 0
3 years ago
Read 2 more answers
Describe what happens when blood in capillaries flows past cells
sesenic [268]
If the blood is carrying oxygen, the cell and the blood will have a sort of trade. The cells will give the blood the waste which will leave the body and the blood will give the cell oxygen which it needs to stay alive and continue to work.
6 0
4 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Ill give away my 1639 points if you answer these two questions correctly please
lorasvet [3.4K]
I don’t know just need points
7 0
3 years ago
List 5 things you should look for when selecting a health club.
lions [1.4K]

Answer:

-Balanced food diets (NOT FAD)

-Management for the time you spend relaxing with activities

-A reward system

-A person to join you

-A place were you feel comfortable

Explanation:

Hope these help :)

3 0
3 years ago
Other questions:
  • Patients with tinnitus experience the constant perception of sound in the ear. True or False
    14·1 answer
  • Explain why you agree or disagree with the diagnosis of fractured clavicle as the reason for the X-ray being requested
    9·1 answer
  • Describe the important of striving for wellness
    9·1 answer
  • Type the correct answer in the box. Spell all words correctly.
    5·2 answers
  • One major focus of oncology procedures is to determine whether or not neoplasms are harmful _ for patients.
    13·2 answers
  • Super sports salads are filled with colorful vitamin-rich vegetables, carbohydrates, a lite dressing, and
    13·2 answers
  • Which of the following technologies would be the most useful to you for monitoring heart rate?
    8·2 answers
  • If your knees hurt after one week walking regimen , which one of the following workout changes would be most appropriate
    7·2 answers
  • What is the most important vitamine for the humain heart?
    6·1 answer
  • Rena developed chronic renal failure and started renal dialysis 2 weeks ago. she feels fine and is working. rena is eligible for
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!