1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
11

How many types of rocks can form from the rock cycle?

Biology
2 answers:
blsea [12.9K]3 years ago
8 0
There are three main types of rocks: sedimentary, igneous, and metamorphic that form the rock cycle. Hope this helps :)
DIA [1.3K]3 years ago
5 0
There is sedimentary, igneous, metamorphic I hope that helped
You might be interested in
What substances can get through the membrane? What type of transport is this?
Serga [27]

Answer:Small hydrophobic molecules and gases like oxygen and carbon dioxide cross membranes rapidly. Small polar molecules, such as water and ethanol, can also pass through membranes, but they do so more slowly.Semipermeable membranes, also termed selectively permeable membranes or partially permeable membranes, allow certain molecules or ions to pass through by diffusion.

Explanation: hope that helps

8 0
3 years ago
What is the disorder that results from the presence of an extra X chromosome that produces underdeveloped genitals, extreme heig
zubka84 [21]

Answer:

autism

Explanation:

autism is caused by extra chromosomes or more than 46

8 0
3 years ago
How do heredity and inheritance relate to the data presented In these charts
Makovka662 [10]
Hereditary is Breast cancer and Inheritance is
Getting Breast Cancer basically it runs in the family inheriting.
3 0
3 years ago
Read 2 more answers
What city is located at 10.5 degrees south, 42.5 degrees east?
ki77a [65]
White’s Beach is located at these coordinates.
4 0
3 years ago
Read 2 more answers
GIVING BRAINLIEST how big is the earth like around the earth?
Marina86 [1]

Answer:

The correct answer to this question would be 196.9 million miles squared.

Explanation:

The Earth's surface area is equal to 196.9 million mi^2. That is A LOT. I hope this helps :)

8 0
3 years ago
Read 2 more answers
Other questions:
  • If a person wanted to explain the trenches at the bottom of the ocean to someone
    10·1 answer
  • Which type of growth can occur only when a population has unlimited resources
    13·1 answer
  • Using a compound light microscope worksheet
    7·1 answer
  • Since cognitive therapy focuses on changing thoughts rather than gaining deep insights into their causes, this kind of therapy i
    15·2 answers
  • The first crops most likely to have been planted by Neolithic people were:
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • 1. Predict: The jar contains helium gas. What would happen if the lid of the jar was removed?
    12·1 answer
  • All living things have DNA in their cells, but not all living things have ribosomes.
    7·2 answers
  • How is the size of Raleigh’s population related to the availability of water in the area?
    7·1 answer
  • Plant cells are generally larger than animal cells. A True B False​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!