1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
asambeis [7]
3 years ago
9

The pressure in the mesosphere is so low that a person could not be in this layer without a spacesuit

Biology
1 answer:
QveST [7]3 years ago
8 0

This is true that the pressure in the mesosphere is so low that a person could not be in this layer without a spacesuit.

The mesosphere is the region of the earth's atmosphere which is above the stratosphere and below the thermosphere. It has a very low temperature and pressure. The top of the mesosphere is the coldest part of Earth's atmosphere.

You might be interested in
Specialized ganglionic sympathetic neurons that release hormones into the bloodstream are found within the collateral ganglia. a
alex41 [277]

Specialized ganglionic sympathetic neurons that release hormones into the bloodstream are found within the adrenal glands.

<h3>What is adrenal gland?</h3>
  • A little gland that produces noradrenaline, adrenaline, and steroid hormones.
  • These hormones assist in maintaining healthy blood pressure, heart rate, and other vital bodily functions.
  • Immune system, blood pressure, stress response, metabolism, and other critical processes are all controlled by hormones that are produced by adrenal glands.
  • The cortex and the medulla, the two components that make up an adrenal gland, are each in charge of manufacturing a separate hormone.
  • Problems with one, both, or other glands, such as the pituitary gland, can result in diseases of the adrenal glands.
  • When the adrenal glands create either an excessive amount of hormones or an excessive amount of hormones from external sources, several diseases may arise.
  • Since the adrenal glands are essential for human survival, if both are destroyed, the patient will need to take drugs and hormone supplements.

Learn more about adrenal gland here:

brainly.com/question/1406904

#SPJ4

8 0
2 years ago
Position time motion
Alla [95]
<span>The change in the position of any object in a given time is known as motion.</span>
7 0
3 years ago
What is a possible effect of an during transcription?
jek_recluse [69]

Answer:

wrong thing will be produced

8 0
3 years ago
Which condition can increase a plant's rate of transpiration?
tiny-mole [99]

Answer:

I believe it is C.

Explanation:

7 0
3 years ago
Is migration an adaptive behavior
Dafna11 [192]


for some people I think


3 0
3 years ago
Read 2 more answers
Other questions:
  • - Which of the following is an interaction in which<br> both organisms are harmed
    11·2 answers
  • Which of the following events MOST affected the passage of National Environmental Protection Act of 1969?
    12·2 answers
  • Geologists might study everything except for a. the moon. b. fossils. c. minerals. d. hurricanes.
    9·1 answer
  • Behavioral vs Physicological
    9·1 answer
  • What is the difference between sensory and motor neurons?
    9·2 answers
  • The process of diffusion of solvent particles from the region of less solute Concentration to a region of High solute Concentrat
    12·2 answers
  • Ricky observed this organism under the microscope.
    5·1 answer
  • During meiosis, chromosomes will split into daughter cells randomly, making each gamete unique. This is Called
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • How do i do this:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!