1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olegator [25]
1 year ago
11

Specialized ganglionic sympathetic neurons that release hormones into the bloodstream are found within the collateral ganglia. a

drenal glands. intramural ganglia. brainstem. chain ganglia
Biology
1 answer:
alex41 [277]1 year ago
8 0

Specialized ganglionic sympathetic neurons that release hormones into the bloodstream are found within the adrenal glands.

<h3>What is adrenal gland?</h3>
  • A little gland that produces noradrenaline, adrenaline, and steroid hormones.
  • These hormones assist in maintaining healthy blood pressure, heart rate, and other vital bodily functions.
  • Immune system, blood pressure, stress response, metabolism, and other critical processes are all controlled by hormones that are produced by adrenal glands.
  • The cortex and the medulla, the two components that make up an adrenal gland, are each in charge of manufacturing a separate hormone.
  • Problems with one, both, or other glands, such as the pituitary gland, can result in diseases of the adrenal glands.
  • When the adrenal glands create either an excessive amount of hormones or an excessive amount of hormones from external sources, several diseases may arise.
  • Since the adrenal glands are essential for human survival, if both are destroyed, the patient will need to take drugs and hormone supplements.

Learn more about adrenal gland here:

brainly.com/question/1406904

#SPJ4

You might be interested in
What types of tissue make up the layers of the skin?
kati45 [8]
Epidermis, dermis, and hypodermis
7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
You dilute your bacteriophage for plating 10^-6. You mix 0.1ml of the bacteriophage dilution with 0.3ml of bacteria and plate wi
Blizzard [7]

Answer:

46 * 10^7 pfu/ml

Explanation:

Given -

Bacteriophage dilution = 0.1 ml

Volume of bacteria and plate with top agar  = 0.3 ml

Number of plaques = 46 pfu

Dilution (d) = 10^{-6}

Final concentration of phage stock is equal to

= \frac{pfu}{d*v}

Where pfu is the count of plaques

d is the dilution and v is the volume

Substituting the given values, we get -

\frac{46}{10^{-6} * 10^{-1}} \\= 46 * 10^7 pfu/ml

7 0
3 years ago
In nucleotide excision repair, damaged dna is excised by what enzyme(s)?
Mars2501 [29]
<span>Damaged dna is excised by endonuclease.
   Three excision repair pathways exist to repair single stranded DNA damage: Nucleotide excision repair (NER), base excision repair (BER), and DNA mismatch repair (MMR).</span>
5 0
3 years ago
Compare and Contrast Producers And Consumers In An Ecosystem.
Elza [17]
Producers create food by them selves from the sun but consumers eat the producers they both consume food. But the consumers get less energy than the consumers cause they pass on less energy than they consume hope it helps



Elite trainer
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which description of Alexander Hamilton is correct? A. a former British captain who turned a disorderly group of American recrui
    8·2 answers
  • a leaf cell has a very low concentration of salt. what would happen to the leaf cell if it were placed in a highly concentrated
    6·2 answers
  • The neritic zone is also called the
    10·2 answers
  • Explain the behavior of the balloons referencing the charges.explain how the distance and direction of john travoltage’s finger
    15·1 answer
  • How does the digestive process in cnidarians differ from sponges?
    6·1 answer
  • use the following term to create a concept map: Chromosome, duplication, cytokinesis, prokatyote, mitosis, cell cycle, binary, f
    7·1 answer
  • Define and distinguish between a hypothesis and a scientific theory
    9·1 answer
  • uhm i have 5 questions due in an hour so please help. It's 45 points and they're all abt biology btw~
    10·2 answers
  • List three characteristics that determine the structure of aquatic ecosystems.​
    7·1 answer
  • The body has a number of systems that protect against infection.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!