Answer:
DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group and a nitrogen base. The four types of nitrogen bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The order of these bases is what determines DNA's instructions, or genetic code.
Explanation:
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
When there are two recessive parents, that means the recessive trait will go into the child. Hope this helps.
These cells are also characterized by having no nucleus, being devoid of organelles. So no organelles are missing from trevor's red cells.
<h3>What is Hereditary elliptocytosis?</h3>
Hereditary spherocytosis and elliptocytosis are congenital disorders of the erythrocyte membranes that cause mild hemolytic anemia. Symptoms, usually milder in hereditary elliptocytosis, include varying degrees of
- Anemia
- Jaundice
- and Splenomegaly.
Diagnosis requires demonstration of increased osmotic fragility of erythrocytes and a negative direct antiglobulin test. Rarely, patients < 45 years of age with symptomatic disease require splenectomy.
With this information, we can conclude that the red cells of Trevor do not have organelles, a fact that is not altered by their condition (Hereditary elliptocytosis).
Learn more about Erythrocyte in brainly.com/question/2908647
