1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
3 years ago
13

Help please stuck on number 4 down16 down 3 across

Biology
2 answers:
aleksklad [387]3 years ago
4 0

4 down is a mutation

16 down is Proteomics

3 across is amino acid (no space)

astra-53 [7]3 years ago
3 0

the answer would be 4 down

You might be interested in
The process by which the zygote attaches to the uterine wall.
frutty [35]

Answer:

implantation – the process by which the zygote attaches to the uterine wall.

6 0
2 years ago
Read 2 more answers
Where is magnet the strongest
lions [1.4K]
The magnetic field of a bar magnet is the strongest at either pole of the magnet. It is equally strong at the North Pole when compared with the south pole. So I would say the answer is A.
8 0
3 years ago
Describe the thickness of the uterus lining during<br> menstruation process.
mestny [16]

Answer:

As the cycle progresses and moves towards ovulation, the endometrium grows thicker, up to about 11 mm. About 14 days into a person's cycle, hormones trigger the release of an egg. During this secretory phase, endometrial thickness is at its greatest and can reach 16 mm.

Explanation:

4 0
3 years ago
Read 2 more answers
Which one of these is not a characteristic of a hypothesis?
weqwewe [10]

Answer:

Uhh-

Explanation:

Bruh there's no pic so ... I dunno lol. Just in case this helps you, hypothesis means an educated guess. There's different meanings, for science it's an idea. But mostly it means guessing.

I didn't help Ik XD

And

Sorry

I

Couldn't

Helppp

.............

:(

3 0
3 years ago
Pathophysiology and treatment of type 2 diabetes: perspectives on the past, present, and future.
Mice21 [21]
Type two is where their are to much insulin but not enough glucose that's all I can say sorry
3 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Liquid-filled thermometers are examples of digital devices True or False ????
    7·2 answers
  • Some protozoans have special organelles called contractile vacuoles that continually eliminate excess water from the cell. the p
    13·1 answer
  • Cooties come in two colors green and blue . green is dominant. show the
    15·1 answer
  • 4 reasons why global warming is a problem
    12·1 answer
  • The situation in which allele frequency in the gene pool of a population remain constant is called
    15·2 answers
  • What is the difference between molecules and compounds?
    14·1 answer
  • The ability of certain specifically shaped molecules to attach to a cell is primarily determined by the...
    7·1 answer
  • ACTIVITY 2: NOW I KNOW!
    5·1 answer
  • PLS HELP WILL GIVE BRAINLIEST need answers by today!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!