1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novay_Z [31]
3 years ago
7

What the process and energy needed?

Biology
1 answer:
leva [86]3 years ago
6 0

Answer:

C. Diffusion and no energy needed.

Explanation:

A - Passive transport doesn't require energy.

B - Osmosis would be if the 25% H2O went into the 82%

D - Active transport doesn't apply because molecules aren't moving across into a higher concentration.

Diffusion is when parts of the 82% go into the 25%.

You might be interested in
What is the name of the process by which the cytoplasm divides in two?
Kamila [148]

Answer:

Cytokinesis

Explanation:

All living cells undergo division, it is the method employed in duplicating themselves. The division of cells involves two major processes viz; karyokinesis and cytokinesis.

Karyokinensis involves the division of the genetic material (DNA) in the nucleus. The chromosomes are initially separated into opposite poles/ends inside the cell. After which the cytoplasm of the whole cell then separates resulting in two daughter cells each having its own genetic material. This process is called CYTOKINESIS.

Although CYTOKINESIS occurs in all eukarotes and prokaryotes, the way it occurs in the eukaryotic plant and animal cells differ in the sense that, in animals, it occurs with the formation of a cleavage furrow as a result of pinching inward of the cell membrane until the two daughter cells form while in plants, a cell plate is formed at the cell's centre and a new membrabe and cell wall is formed around each cell plate.

4 0
3 years ago
According to the theory of endosymbiosis How did cells acquirenhow did cells acquire chloroplast
stira [4]

According to endosymbiotic theory, the chloroplast evolved as a result of engulfment and assimilation of a Cyanobacteria by an eukaryotic cell.

Explanation:

  • Endosymbiotic theory supports the view that ceratain organelles of the eukaryotic cell evolved as a result of engulfment of single celled organism.
  • Evidences  that support this theory is the presence of organellar DNA.
  • It is assumed that Mitochondria evolved as a result of engulfment and assimilation of an aerobic prokaryote while Chloroplast evolved due to engulfment and assimilation of a photosythetic prokaryote by an Eukaryote.
  • After the engulfment ,these organisms however escaped the phagocytosis and began to benefit the eukaryotic Host.
  • Soon it lost many of its Genes to the eukaryotic nucleus and became dependent on the Host.
  • Thus a symbiotic association was established between the prokaryote and the host.Giving rise to cell organelles.
7 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
To help explain surface tension, use a single water molecule in the template, and draw arrows representing the possible location
kramer

Answer:

The correct representation is attached with the explanation.

Explanation:

In this representation of the surface tension, blue arrows between green water molecules are the possible molecules that can be used as the location for forming hydrogen bonds by a single molecule. Surface tension is the tendency of a liquid surface strectch to neighbouring molecules or ability to shrink in minimum surface area possible. Hydrogen bonds is an intermolecular force or interaction responsible for the surface are of liquide molecules. This bonds is towards every direction where the similar molecule present.

3 0
3 years ago
In an animal cell, which two cell structures do newly-synthesised enzymes have to pass through to reach the external environment
ss7ja [257]

Answer:

Ribosomes, Cell membrane

Explanation:

Ribosomes can be described as structures which are involved in the production of proteins. Ribosomes are hence known to be the protein manufacturing units of a cell. As enzymes are also proteins,they will be synthesized in the ribosomes.

Cell membrane can be described as the membrane which is present outside the cell or which separates the cell from the external environment.

For an enzyme to pass through the external environment, it will have to pass through the ribosomes and the cell membrane.

4 0
4 years ago
Other questions:
  • If 2 organisms are in the same phylum, they are also in the same ____________.
    13·1 answer
  • There are certain individuals who are unable to distinguish colors. these people suffer from __________________.
    9·1 answer
  • Unlike plant cell animal cell contain
    5·1 answer
  • (Answer fast for brainliest.)
    10·1 answer
  • When warm air moves over cold air, a warm front forms. The warm air tends to rise along a gentle slope above the cold air and fo
    13·2 answers
  • Please help I’ll mark you as Brainlist or whatever.
    8·1 answer
  • Which traits make fungi more related to animals than to plants? (4 points)
    7·1 answer
  • What is the main cause of the damage to trees on Grandfather Mountain?
    12·2 answers
  • What would happen to the liquid levels in the glass tube ​
    7·1 answer
  • Which Statment did both Aristotle and Ptolemy assume
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!