Answer:
Osmosis is the movement of water from areas of high concentrations to lower concentrations across a semi permeable membrane. It occurs over these membranes in cells of the body alllowing water to move into and out of them.
Explanation:
Answer:
1) Skull and Vertebral column
2) Meninges
3) Cerebrospinal fluid.
Explanation:
Central Nervous system:
CNS is the abbreviation of Central Nervous system. CNS controls the whole body functions so it is the most important component of the body. CNS consist of two parts 1) Brain and 2) Spinal cord
Both of these organs are very important and hence need to be protected. Nature provided these organs with certain protective mechanisms these includes
1) Skull and Vertebral column:
Skull is present around brain and vertebral column is present around spinal cord. These structure provides mechanical support to soft parts of CNS.
2) Meninges:
These are the membranes that provide antiseptic environment to the brain and hence protect it from microbes and other harmful substances.
3) Cerebrospinal fluid:
This fluid is present inside meninges which nourishes the brain and protect it from mechanical stresses.
Answer:
1
Explanation:
Omnivores are animals that eat both plants and animals. If you look at the bottom of the food web, you need to look for arrows that point towards an animal that also consumes other animals. The arrows indicate that the energy is being transferred from the plants to the omnivore. The Raccoon is the other organism that eats both a producer (blackberries) and other predators such as garter snakes and meadow voles.
Hope this helps!! Comment down below if you have any questions and please considered marking me as brainliest!!
Answer:
The most basic function of the cell cycle is to duplicate accurately the vast amount of DNA in the chromosomes and then segregate the copies precisely into two genetically identical daughter cells.
Explanation:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
