1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
9

Yler is admitted to the hospital after an accident. In the hospital, Tyler overhears the doctor telling his mom that although he

has a fracture in the axial skeleton, he's lucky because the bone doesn't protect any vital organ that's essential for survival. Which bone has Tyler fractured?
Biology
1 answer:
larisa [96]3 years ago
8 0

Tyler has broken his sternum. The sternum is the breastbone

You might be interested in
What are amino acids made up of?
lubasha [3.4K]

Answer:

Amino acids are made from natural materials.

Explanation:

6 0
3 years ago
Read 2 more answers
Name 2 multicellular organisms and 4 things that plant and animal cells have
matrenka [14]

Hi! human,dog are multicellular organisms. Nucleus,cell membrane, cytoplasm and mitochondria are 4 things that plant and animal cells have.

3 0
3 years ago
What is the process of water moving down through the cell call
lidiya [134]

Answer:

Osmosis

Explanation:

Water moves across cell membranes by diffusion, in a process known as osmosis.

8 0
3 years ago
Describe the process of skeletal muscle contraction by assembling the following 10 events in the proper order in paragraph form.
balu736 [363]

5) muscle fiber is stimulated at the neuromuscular junction triggering an action potential  

7) APs travel down the T-tubules to the sarcoplasmic reticulum  

Released acetylcholine (due to action potential within motor neuron) from the motor neuron initiates depolarisation within the sarcolemma, which is spread through the muscle fibre via T tubules.

8) in response to an AP, calcium ions are released into the cytosol/space around the myofibrils

Depolarisation causes the sarcoplasmic reticulum to release calcium ions necessary for the contraction

3) calcium ions bind to the T and T system

1) T and T system undergoes a conformational change, exposing the myosin binding sites on actin  

6) myosin head/cross-bridges bind to actin

The binding sites for the myosin heads located on actin, are covered by a blocking complex (troponin and tropomyosin) that can be unblocked by the calcium binding

2) myosin heads/cross bridges bind to actin and flex, shortening the sacromere  

4) actin filaments are pulled toward the center of the sacromere, shortening the muscle fiber  

As the individual sarcomeres become shorten the muscle fibres as a whole contracts

10) myosin head continues to attach, flex, release, extend, and reattach as long as calcium ions are present

9) calcium ions actively transported into the sarcoplasmic reticulum  

Relaxation of a muscle fiber occurs when a Ca ions are pumped back into the sarcoplasmic reticulum .

3 0
3 years ago
The accumulation of small changes in a gene pool over a relatively short period is called: A: anagenesis B: cladogenesis C: micr
aleksklad [387]
I believe it is microevolution
6 0
3 years ago
Other questions:
  • The maxilla also frequently sustains fractures from blunt trauma to the face. which structures support and house the upper teeth
    6·1 answer
  • What is the primary function of the lymphatic system
    10·1 answer
  • Water vapor in the atmosphere is important for which of the following reasons?
    10·1 answer
  • Animals that use language are most likely those that have the greatest capacity for
    9·2 answers
  • cells contain a specific balance of salt and water. what happens if a cell is dropped into container of pure water
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of these is not an edible root?<br> a. Carrot<br> b. Turnip<br> d. Sweet notato<br> c. Ginger
    12·1 answer
  • The main function of the kidnenly is​
    8·1 answer
  • Which of the following BEST represents the meaning of empathy?
    7·2 answers
  • Human mitochondrial diseases, such as leber hereditary optic neuropathy, are usually ______ inherited.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!