1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
3 years ago
12

What characteristics Of bacteria would enable you to know it is a prokaryotic and not an eukaryote

Biology
1 answer:
avanturin [10]3 years ago
8 0
Prokaryotic: singular chromosome and no real nucleus - lack membrane bound organelles (ie. bacteria & archea)

eukaryotic: multiple strands, with a nucleus - membrane bound organelles. (ie. animals & plants)
You might be interested in
What best describes the purpose of technology
fenix001 [56]
The creative use of science to solve problems.
8 0
3 years ago
Aquatics science I need help
7nadin3 [17]

Answer:

Substance C

Explanation:

From the statement scenario, it is given that no water remained above substance C. This then means that substance C actually absorbed all the water above it faster than the two other substances.

Therefore, we can deduce that substance C has the greatest porosity. This means that it has the highest amount of spaces within where the water can be absorbed.

Porosity has to do with the available empty spaces which is within a material. This property allows materials or substances to absorb other substances that are absorbable.

7 0
2 years ago
Which of these is a characteristic of a parasite? A. It is a helpful organism. B. it lives inside or on a host. C. It makes its
lara [203]

Answer:

B it lives inside or on a host

Explanation:

that is the definition of parasite

4 0
3 years ago
Read 2 more answers
The type of soil that has the least amount of space between the particles is _______.
Alex_Xolod [135]
The type of soil that has the least amount of space between the particles is clay.
6 0
3 years ago
Read 2 more answers
Embryonic stem cells have shown promise when used to treat certain diseases. Despite this, there are many people opposed to stem
Advocard [28]
B) Embryonic stem cell research requires the use of human embryos. Its an unethical dilemma.
3 0
3 years ago
Other questions:
  • Why do all objects on the celestial sphere rise in the east and set in the west? (this answer requires much more detail than jus
    7·1 answer
  • Which of the following correctly pairs a biomolecule to its function
    13·2 answers
  • What is responsible for transport of amino acids to the ribosome during protein synthesis?
    14·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • This type of molecule is composed of a sequence of
    5·2 answers
  • Arthropods like mites and ticks can transmit rickettsial diseases True or False?
    11·2 answers
  • Protestantism and english nationalism gradually fused together as a result of _____.
    12·1 answer
  • List 5 anthropogenic climate change causes
    12·1 answer
  • 1. Do these results support the claim that application of the jewelweed is a good treatment for symptoms caused by poison ivy? E
    11·1 answer
  • The mucinous glycoprotein covering teeth that streptococci attach to is called the ________.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!