Ask question

Ask question

All categories

3 years ago

12

Collections of lymphoid tissues, called MALT, are strategically placed throughout the respiratory, digestive, and genitourinary

systems. Which one of these is located at the end of the small intestine?
a) appendix
b) Peyer's patches
c) tonsils

1 answer:

tatuchka [14]3 years ago

5 0

B) Peyer’s patches. Located in the mucosa and extend to the submucosa of the small intestine

You might be interested in

Farmers are growing more genetically modified crops. Which of the following questions BEST helps determine the benefit to

Doss [256]

Answer: The correct option is B.

Will genetically modified crops increase profit for farmers?

Explanation:

This is because genetically modified crops are produced to achieve a particular advantage. Genetically modified crops are produced with some traits that are beneficial to Agriculture. Farmers choose genetically modified crops in order to increase yield, and produced crops that are resistant to certain diseases. These genetically modified crops are produced because of the traits that increase crop yield when farmers plant them it will increase the profit of farmers.

5 0

3 years ago

How did the team determine that the body was placed in a woodchipper?

Lesechka [4]

Ummmmm...........huh?

7 0

3 years ago

Why will the footprints left by Apollo astronauts last for centuries?

Nastasia [14]

Due, to know life on the moon there would be nothing to mess with the footprint, but the main reason why these footprints are going to last centuries is because "there is no weather." Since how there is no weather on the moon which means no wind there is no factors that could affect the footprint.

Hope this helps!

7 0

3 years ago

Read 2 more answers

PLEASE HELP QUICK!!!

astraxan [27]

Answer:

c. Both A and B are correct

Explanation:

Punnett squares are in the image

8 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago